Description :
From Genome Similarity Track
Location :
Scaffold_281:31717- 34534
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_281-snap-gene-0.18Gene of unknown function

Sequence
2817 bases(100 bases per row)
AACGAGAGTGGTCAGTCGATCATAGCTTCAGCGAGTTGACAACAGCACGATGCGGAAATGGCTGAGACAGACTTGCTTTCTGCTGCCCAGTCGAGAAGGG
CAGCCACCCGATGTCGCTATATATACCATAAAGTGACATTGTTGGCAGTCGGCGGCGCAGGAGAAGCTCCAGTTCGAGCTCCAGGAGCTACACATGCAGA
GTGTGATTCTACACGACGACAGCAACAACAAACACATGTTCTACGTCGGCTTGGAGATGTAAAGCTGCATGAAGGTGCATACTGGCGTGTTCTCGTCCAG
TGGGGACTGCACTGAAATGGGAACCTTTGATGATATCAGTCCCGTGAAACTGTGAGTATCGTAAATCCTTATCGAACGTATTCATGCCCTGTATCCTTCC
GTATCGCGACGGGTACTCGTGTCCATGCGTGAACCAACAACTGATAATGTGGATACAGTATCATTGCAACAATACTATCAACTTTAGCAAGAAAATCACA
GACAAAGAAAGGGAAAAAGCTTATCTACTTTTTTGAAAATTACGTTCGAGAGCAGATCACACAGATAACTCGCCATTTTGGATCTGGAACCTTACTTCTG
ACTTCTGACTTCTGCGCTTGCTTCGAAGAAGCATCGATTTTTCTGTGTCGACCCTGCTTTGCGTGTATGGGCGGTACATTTTGGCAAGATATGAGCCCAT
AACTAACGTCGAAGCGCGCTTCACAATCACAATCATCATCGTTTCTGAAGCGACAACGTGGGGTGCTTACGCGGAGAAACGTCGGATCGCTTCTGAGGGA
GCCTGAAGTCATTTGTTTTGTATAGATCAGAGATTTGCAAATGTCGCAATCTCCACCAGCGCTACACTTCACGAAAGACCCAACTCTTGGCGTACCTGGA
AGAATGAAGTGACCCAGGTGGTAAAAAACACATGAGCGCCAGCGATTTTTCGATTGCTGAAAGTACAAAAGGACGATCGAATTGTCAGGTTGATATGCAA
ACAGCCCATAGACGGGGTAGAGGCCAATCACCAGAGCAGGAATGATTTTCCCAAGCACAAGACTCTTGCTACAAGAGCCATACCGGTGACCTGGTCCATG
TATCCATAATTGGCCAAGTCCAGGTCTCGCAAGCTGCTATGTATGTAATCATTGCTGGTAGCCAATCTAGCGGATCTGGATGAGCGAGTTGAACAGGATC
ATGCCATTGACATACGTTGACGGTTGGGGCTGCCTGCCACACATGAGGCTATGCAGCGACATCTCTGGAGCCGTTGCTCCTATTTTGGGTGCTCCGAATA
CATATCTTCAAAGGACATTGCCGAACGGATTGACAAACTCTAGTCTCTCTTTTTACATCAATCATCAACGCCGGCATCTCCAGGTTTTCGCTGTCGGGCC
CTGTCACAGAGCGAGCTGGACCGGCTTTATGCAAGGAGAGCCTCAGGGTCTTGGATGCCAATTCACAACGCGCGCGTTGACCATGCATGTTGACCGGCTA
CAGCTTGGTGCCACCATCGGGTCTGCCAATGGGCGAGCAGCAGGCCAAGCTGTGCGCGTTGACGGAGTGCAGGGCGCTCAACCTGACCGACTGCAAGATC
CTGGACATCTTGAACGTGCGTGAGCTCGTCTTCAACTTCGACGACACGTGCGCCAAGATCACGGGCACCCCGGCCCCAGTCCCAGCTACTGCCACCCCAT
AGCCAGCCGCGGCCGTCCTAGCCAATCCATCGTGCTAAGCGGACTCAAAGCAAAGAACTACTGCTGGTACGACGGGTGACGATCCACGCTATAAAGCTGT
TGGATACGCTTGTTCCGCTCGTTTGGCAGATTCACTCACTGTATGTAACCCATACCTATTTTGAAAAATAAACACGGTTTGGAAGGACAAACCAAGCGAT
TCTCGCTATACAGCAAAGCTTGTCAGTCTCCCTCTCGATCTTTTCGAGATCTGCTCTGTTTGGTTCGCTTTATTGCCACCGTTCTCGCTGGGCACAGAAT
GACATGTACGGTAACGTGAAGCGCGAATTACTTGGCCCTGTTGCTCCTGCCAGTAATCGTCCCACGATTGAGATCAAATGCAAGAAGAGTTCAGACGTGT
AGTCACCAATGTGGATACTATGGAACCCTTCTACGGTGCTCGGGTCACGACGACGGTCGCTGGGACCTCGAGAGCTCCAGCACCATCGCTCGCTTCGTGC
CAGGACCACACCGGGGAGTTCAGCCTTACACGCTGTATCGTTCTACCCAAAGGCTCAGCGACATAAACTAACTGAAGAACAAACTGCCGAAAGCTGTGCG
CAAGAGGCTCGGCCGACAGTTTTGTTGAGTGTTCCGGTTCTCAATCCATCAATCCATCAATCTCCTCCTTGATGCGAGTCTGTGAGTTGCGGTCATGTTG
ACCCCATGGTCCTCTCGTGATCTTGATCATGGTTCTTGTATTCGAGGGAAAATCGAATATGATGCTACGGATGTTTGGTCTCCGCTCTGCTCGCAATAAG
CGTCATCCTCGGAGACTTTCAGGTTTGCGCTCTTCGAAAATGCATCGTGTCGCCCAGTGAGTTGCCCTGGTTCTGCTCGTACGCATTGGCATTGACCCCT
CCAATTGGGATCTGAAGATGCCTGCAAGCCTGGGACCCCATGCATTAGCATGCGAGGCGAGCGTCGCAAGGCCTTTGGCATCTAGAGAGAGAAGGAGCCT
CCTTCCTCTTTGCTCAGCTCCGCTCCTCCTTCAGACAATTCAGTCTCCCGACTCGCTTTTCTTCCCTTCTCGTCATTCTGCAATTTGCTCTCAACTTGAG
CAGTCTCCCCCCCCCCC