Description :
From Genome Similarity Track
Location :
contig_3:317168- 319591
Transcript NameFunction/comments
g906.t1XP_008902013.1 hypothetical protein PPTG_09000 [Phytophthora parasitica INRA-310

Sequence
2423 bases(100 bases per row)
TACAAATAGTGGCAACTCGAGAGACGGCAAAGCTTCGTCGTGAAGCTCAAAGCGATCACACTGCTGAGTCCGATCAGTCTGTAGCAAAAATTGATGATAT
AGCAGAGGAAGAAAAAGACGAGAGCGCTGCCAGTCAGAACAAAATGTCCGGACTATCGACGCCATTCACGAAAACTGCTCGCCCAGGGGCTGGAATTCTG
GTCTCACTCAGCGGGTGGACAACAAAATTTCCGAGTCAAACTGAAAGTGATCAAACTGTTGAGTCTGACGAGTCTCTGAAGAAAATCGACGAGGCAATAG
TGGAAGGAGAAGAAGTGTTCACTGCCATTTGGAGCGAAATGTCCGGACTAGCGACGACATTTAAGAAAAATGGTGCCACCTCCTTATTTGCTGACACTCT
GGCACCATTCAGCGTTTGGTACTTTCAGGATCCTGCTCTCGTTGAGCAGCTCGGCTGGCAGGCATTTGAGCATTATGTTCGGTTGTTGCGGTGCCAAGTA
TCCGACCTGATAAGTGAAGGCGGAAGGTAAATTTAAGAGGAGCACATCGTTTTATTGCTCACTCGAGTTGTTGGAGACTAATATTTCTGTATGTGTTGTC
CGGTGTTTAGTTTGTGCTAGCGAGAATCAAAGGGTTACTAACGTAGAACGTCAAACACCTCGACAGTCTATGGAAACAACACAGGCAAACCCTTGTTCTT
GGTCCAGTCCGTGTCCTTGCGAAAGAAAAGCATGAAGGCTGAACTGGACGAACTCACGCAGCGACTGGAAATGTACCGTGACACCTACGACACCTACACT
AAAAATCGAGAAGGTAAATCATGACCAGACGCGACGACATTCAGAAGCTGTACGACGCGGCTGATGCAAAGGTCGGTAACGCGATCAAATTCCAAGCGGA
ATTGTGGAAACGCAGAACGGACGATGTGAACAAGTTACTGAGAGAGGTGAAGACCGATGTCATGCGCCTTTACGGCTGTCATTGTGGTGAAGCAAGGAGC
ACCATGACATGTGGGCTGCGCTCAGTGAGTCTCTTCCAGAGGCAAGTCTCACACTACATTCGATTGGCTGGATGAAATCTTGGTATTAACTTCATGCTGG
ATCTTGCTCAGATTATGCGTGGTGGTAGGTGGTCTCCGACCAGAGTTCCATGATACACTTGTGCTTAAGTGCAGCTTGCATTACGAATGTCAGTCCGCAG
CCAACAAATCCAAGCTGTTAATTTCACTACGCCATTTGGCGATCACCGGCACAAAATAACATCTGTCCAGCAACACTACCAAAATACTACTGGAGCCGTC
ACATTATCCAGATGGAAGCTAGAATAGGATGCCATGCGGCTTCATTTTGGCGGCCGGCAACCAACAAAGGCCAGATGACCCACACGAAAGAATCAGAAGG
CACGACACGGACGAAATGGGCGCTCGATCGAAATCACTCGAACCACCACTTCATTGTCCAATTCGACTTGGTCCGCACACTCGAGCTTCCTTCAAACCGC
AACAATGACCAAGCTTCTCACCACCGTCGCCACCGCTACAATTGCAGCAATCGCAGTTACAAGAGCCACCGCCGAAGACAGCTGCGTGTTGGTGGACTTC
ACCGCCGAAAAGTCCGAATTCGCTTCTCTCAATGCTGCGATCGACCTCGTCAAGGCTGCCCACGTGGTTGATTCGATGTTCGGGGAGTATGACCCCTTAG
TTCTGCATGACATTACGCTCGGCGAGTTCAGCCACAGTCTTTTGGGGCAGAACCTGACGATCGTACCCACCATCGACTCGATGAACGTCACAGGCCTCAC
CACCTTCGCGTTTGATCACGTCAACGTCACGTCCTCGAATTGCGTCGACGTTGGGGTGTACTCGGATGCTGAAGTGTCGGTCGACGCTACGTTGAGCATT
TCGCTCAAGGAGCTGGATGCGACTGCCACCGCACACGTAGCCTTGGCTTTAAAGAAGCCAAGTTTTACGGCCAATATCGAGGCGAACATTTACGCCTGCG
CACCAGGCGTATCCACGACTTCATGCTCGAACATGACTGTTGTGGGGATTCAAACCGAGGTGGTCAGTGTTTCCCACGGTGGCAGCTACAGCAACATCCT
AAAAGAGGTGCTCATGAAGTTCAAAGACGCGTCGGTACAGTCGTTCGCTCTGGACTTCTCATCGGTGTCTACGTTCGACATCAGCTTCGATAGCTCCAGC
TCAGTGTTCTCGTCGATCACGAGTCTGCTCACTGACTACTCAGCAAATGAGATCAACAAGAAGGGCGACATCTACGACACTCTCATTTCCACTTGCAACG
ACGAAGTGCGACTGCTACTTAATGATCTCATTGAGTCGAAGCTGAAGCCCCAATTTGGGGCTACTTGCTTATCTGAAAACTAGCTGGTGAGTGTCGGCTA
CGTCACGTAGTGTTTACATGTAC