Description :
From Genome Similarity Track
Location :
contig_50:31712- 34585
Sequence
2873 bases(100 bases per row)
AGGCTTCTCCATGACAAGCCAACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAATTTTCAGAGTGCTTGGATTTTGCAACCCCTTGTTAGCCATCGAT
TCAACACCTCCATCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCCTGGTCGAACGTTTTCACGTAGGTGAGCCACGTCT
TGAACAGTGGATTGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAGACTTCATCGGGAGATTTGTTGCTGGCGAGATAGCTCTGGAT
CTGATAAGTATATAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACGGAAGCCTTAAATGACTAAACGCTG
CCCAGCGTAGTACAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGTATAAAATCCAACCGATGGTCTGTC
CCTTCCAAATGAAACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAAGCGGATAGTTGCCAGCACCGGTAC
CCTCGACCACATTAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGA
ATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCG
CGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTC
ATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATA
GTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAG
GAAACTTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTG
GTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAAACCGGCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGA
GCGAGGACCGCAGACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCG
TCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGG
CGAGGTCGATGAAACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACA
AGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGGCAC
TTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCC
AGATTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTT
ATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAACGCGCACCA
CTCTCAATTAAGAGAGAAACTATCAAATACTATAGTCAATCGATACACACAGCAGTTAAACTATCACTTCGGGGGACAACTGCTAGTCAGTCACCTCGAA
TAGCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCA
CCACCTAACTGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGT
CCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGGTAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAACTCTTT
CTAGATCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCA
AAAGTGTCGACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGT
CAACCGTCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCAC
GACTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAAC
TGCACTTTCCGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAA