Description :
From Genome Similarity Track
Location :
Scaffold_675:3171- 6090
Sequence
2919 bases(100 bases per row)
CTAGACGAAATTTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGACTCGATGTCGAGTTGAACTCGTCCT
CATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCAATCAGTGCCCAGAGTGGATCTTCGCCTTAAAGATCCTTTGGGTCCATTCTATCCTTTGG
TAAAGGAATTTCAAGATGTGGTGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAAGTGTACGTTATGAAATTAACCTAGTTCCAGGAACTAAATA
CTGCGTAACACGGCAGTGGCCGTTACCTAAGAAACATTGTGACGTCATTGACGATTTCTTTCGTGCAAAGCACGCGGCTGGAATGGTGCGTGAGAGTAAA
TCTCCCCATTCCACACCTATATTTTGTGTCAGGAAGCCAGATAATAAGTGGCGCATTGTCCATGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATC
CCCAGAAAAGATGCTCTTCAGGACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGGTATTACCAGCTGCTCATGCGTGCAAGCG
ATATTCCGCTAACCGCGGTTAGTACCCCTAGCGGTATGCTCTGGGGGTGGCTCGTTATGCCACAAGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTG
GTGACGCAATTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCATGCAACAAACGGTCGATCTGATGTGGGTA
ATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAATTTTATACAAATATCTAAGTGCATGTTTGGTGCAGAATAGATTCCCTTTC
TGGGATACTTCATTGGGAAGCGAGGCCTCCTAGCGGACCCCGCTAAGGTAAGGGCCATATTCGATTGGCCGGTTCCAAAGAACCAAAAGATCTACGTAAG
TGGCTTGGCCTTGCCAATTACTTGCATAAGTACAGTGCGAATTACGTAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTT
GGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCAGCATGCACCAATACTGGCTTTGCCCGATCCTGATAGGCCTTTCAGTGTCGT
CTGTGACGTATCTGAATTTGCCATAGGAAATGCTCTGTTACAAACAGATGTCGATGGACGCGACCGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCT
GCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACCTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGCCTCAAAGCCATTTGTGA
TCTATACAGATCATGCATCATTGCGCACCGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTTTCACTCTTTGCCGAATATAACTTCTA
GTAAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGACCTGAATATGAGCTTGCTCACGTCACTACGCTATCATCGTCAGTCA
CTGACTTAATCCGGGCGGCTTACACCATTGATGAAAAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAGACTCGGACATAGAATTGTC
GGCACGTTTACGTGCGAGGCTGCATCGATATTCTATCGATAATGTCCTGTTGTGATATCGCACAGATATTGAGGATAACTCTTGTATCGCTGTCCCTCAT
GATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTTAGTGGGCCAGGCTT
ATTGGTGGCCCCAACTATACAAGTGGATGAGCACCTATGTGCGTACGTGGAAACGTGTCAACGGTTAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTA
GTCTGCCTGTACCCACTGGGTGTTGAGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGACAACACTGGCATTGTGGTCTTTGA
TGACCAATTGGGCAAGATGGCTCATCTAGCGGCAGTGCCGGATTCTATTGATGCCGAAATTACATCGAAGCTGTCTATCGACCGTGTGTTTCGACAACAT
GGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTACATCTTCAAGGTTCTCCGCACCGTTTGGACATGTGCAC
AGCGGATCATCCGCGGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGC
TCCATGCTCTCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTACATGCTATACTCCTTTCTACGTAAACGGTCCCCCCCCACCCTCGCGTT
CCGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTGATACCAGCCATGCTACTGTTCAAAAACAAGTAGGCG
AGTTTCTCGCAACGCGATTGAATGTCTTACGACATTTGCGTGACGCAATGGCTGATATCCAAGACAATTATAAGGAACAAGCGGATGCTAAAGGCAGAAG
CTGTATTGAAAGTTATGAGGTCGGATACCAAGTCTTACAAAACGCTAAAAACCTGCCTTCAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTCCG
CGCTTCATTGGACTATTCACGATCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGAAAATTGTGCACACATCCTGTGTTCTACGTTGGCT
TGCTTAAGCCGTATCGGGA