Description :
From Genome Similarity Track
Location :
Scaffold_303:3171- 5326
Transcript NameFunction/comments
Phypl_g6706hypothetical protein PHYSODRAFT_523894
Phypl_g6707conserved hypothetical protein

Sequence
2155 bases(100 bases per row)
CCTGGTGCCAAGTTCATGATGCTCGTGGATGATGATGTTTACTTGAAAACTGATCAACTCAGCGAGAATCTACTCAAAGCAAACCGCCCGAATCTGTACT
TTGGTGAAGTTTGGTCTGTGAAGTTTGCAAACAGACAGGAGCCAATTCGCGACCCGGAAAGTCCGTATCACCTTCCAACGGATCAATACCCGATGCCCCA
CCTACTGCCATACGCGTCCGGCCCCCACTACGTTGTCGCAATGGATAACGTTCGCTTCATTTCCAAGAACTActggcgcttgagcagcatgaATGGTCTC
GAGGACGTGAGTTCGGGGTTCTGGCTTCGGACTATGCAAgtgcacgcgcagcacacTCGAGATTTCTCCAGCGTGCGTTCGTCCATGGCGTGTGAAGACA
ATCTCGTGTCGTTCGCAGACCTGTCGCCGCTCGGTATCCGCTCGATCCATGCCAATGTCCTTCGCAACCGGATCTTCTGCCACGGGTTCCACTCCGTCAC
GTGGCATCGCCACTTGAATTCGATccccgagctggaggaaatgCTGCAACGACCGACTCAAGCGGCAAATGAGTCGCCTTCACTACAATTCGAGACGCTC
ACGGACGCTTTGGATCTCGATCGAGTGACCGTCATCGTCTCCACTCCCTCCCACGCCGGAATGAAGTGGCAATTCCTCTCCTCAGTCGAATCCGTCGAAA
CCTTCACCCAGAAACTCGTCACTCAAGCTCGACATCTCTTCCCAGACCCCACACCAACTCTCACGACGACACTACTTCATGAGCTTCAACGTATCCTCCG
TTTGCCACCTCCGTTTGCCACGTCAGAACCACACTTTTTAGGCTAAAATCTCCTTCCATACTCACTTCAAGTCACCGCCAGGGGAGTTTCAGCTCTATGT
TTACTTTTTTGCTCACCTCTTCGTGGCACGTCGAACGGCACTGCCACTCGGCATTTCGCTCCGCTCCCAAGCTCCCCCTTGTCCGCCATGAGTCGCTCCG
GAGGCCCCCGCGCGCCCGATGACCAgacgaagctcaagaagcagctgaacgagctcatgaagctcgaggagaacAAGTTCTGCGCCGACTGCGGCTGCCG
CGGCCCTCGCTGGGCGTCCATCAACCTCGGCGTGTTCATCTGCATCGCGTGCTCGGGCATCCACCGCAGCCTGGGCGTGCACCTGACGTTCGTGCGCAGC
GTCAACTTGGACTCGTGGACGgcggagcaggtgcagcagatgcagcgctgggGCAACACGCGCGCCAAAGGCTACTACGAGGCCAACGTACCGCGCGACT
ACCGCGTCCCGACCGAGCACTCGGCCGTGCGGGAGAAGGAGATGTGGATCCGGGACAAGTACGAGCGCAAACGCTTCGTGGGGGAGCCCCCCAGAGAGAG
CGACgaccgcggcggccgccggaagaagcacagcagcgacgaggaggacgaggagcaggacgagcgccgtcagcgccgcagggagaagaaggagcgcagC
TCTGGGTCCCGTCACGGGTCCCGTACGGCCTCACGGGAGGCTACGCCCACGCAACCGGCGGTGACGAAGGACATCTTGTCTTTTGACGTGTTCAGCGCCC
CCGCGCCGGCGGCTCCgagcttcgtggacgccccagtggctgctgctgctcctgcgccgAAGCAGGACGAGTGGGCGGCGTTCGGGGGGTCGACGAATAC
CCAGTCCGGGTTTAAGGACGCCTTTGCCCCGCAACCCGCGGCGCCGACGGACCAGCATGTGAACAAGATGGCCAACATCATGGCGAGCTTCGggccgtcg
acgcagcagcagccgcagcaacagcaacagcagtTCCCTCCTCAGCAGGGGatgccgccggcgccgatgaTGGGCATGCAGATGAATGGGATGAACGGGA
TGGGCTTGATGGCCCCGCGTCCGATGGGGATGAACATGCCTATGAGCATGCCCATGGGCGGGCAGGGATTCATGAACCCCATGATGGGGCAGCAGTCCAA
TGTGATGATGGGATACCCCATGCAGAACCAAATGTTCGGAGCCCCGCAGCAGAACGGCATGATGATGGGTACGTGAAGCAAATGTGAAATTGTTGAGGAG
TGGAGTATTGCGGGGGGTATTTAActttggtggtggtggtctcAACGTAGGTGGC