Description :
From Genome Similarity Track
Location :
Scaffold_113:3171- 4199
Transcript NameFunction/comments
Phyca_LT1534131786gag protein

Sequence
1028 bases(100 bases per row)
ctctcttcgacataacattcaggatgacaagattcggcttgtcatcttgcaacttgcagcgagaaacgttctcgctgggggcagcagtcctcatcgtcgc
gtgtccaagttcgacacgcgagaccgcatcaccagtaggacgccccgcgcctactggttcttggcgtttttttgaacgcccgcccggatgcacagtcgct
gtgcattcgcgtgcaaagtgaccgatgttactacacatgtaacatcgtaccttgaagcccttacgctgctggtgaccagcagtcgtagcactcggaaggt
ccataggctccggacctcccgccttcggtacaggtcgcatggggtttagcttgacgcctgctaatcccctcttgcatcgcaaggcatatggcttcctcga
gagtattcggatactctcgaaagaggtatgtcttgacgggaccgtctctcagtcccttcatgaacgtgacgaccttggtcgcctcgtcgaccgggttggc
cactatgttcgatactaagtatcgagcacgctgggcataggaatgcacgtcatccttgccctgctgcagatcgaggaactccgccctcgatctgaactcg
ttcttcgggggctcaaacgcgagcttgagctcctccttaaaaccttcgtacgtgccgaagcgcgtaggatccgagagtcggcgcccataggcctaactcc
tcgcgcgtccgcccaagcatgacatggcgaacgcgactttcgacatcgggtagacgatacgtcgagccgcaacggctgtgtcgagcccgacaagccaacg
agggagggtctcgtcctccttccccgcataggtactcacgtggagtttcaacgactccacgcgtggcttcggggaagccaccgatgcagcaacatctcgt
ttctccttaacaatggaccccagagcaacactgtgttgctctgtcggcgataacatgcagagcatcgctgctaccgctgcctctccaatgactcgcgaga
gtcgttggagcgcctcccactctgggtc