Description :
From Genome Similarity Track
Location :
Scaffold_12:31708- 34296
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_12-abinit-gene-0.91Pseudouridylate synthase
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.21Mannosyltransferase

Sequence
2588 bases(100 bases per row)
TGGCGCTACTGTCTGCACATCGCGTACTTCGGTACGGGCTTCGTCGGGTGGCAGCGGCAGAACGACAAGAGCAGCGCCGGGCTCGGCAGCGTCCAGGAAC
TGCTGGAAGAGGCTGTGACTGAGGAGCTCCGCGCCGAAAAGCGGATCAACGTGACGAGCGTCAGTCGCACCGACGCCGGCACGCACGCGCTCTATGTAAG
ACACTGCGGTTATGACGATTTGGTGGATGAGTGCAATGTTTATTGATCAGTGAGATGGATCAAATCCAGCAATACGGCTCGATTCGACTGCCTGAGGAGC
TCCAGATCCCACTGGACGAGTTCGCGGCGGCGCTCAATGCCAGGTAAGGATGAAACAATTGCTGATTGAGACTGTTCACTTTGAGAGAAGCGAGAGGCGT
CACTATTGAGCGGGACTGAACTGTTGTAGGCTCCCTGACGGTGTCGTGGTTCACGGTGTCACCCGCTTGGAAGGACCGATCGCGCGGACGCGGATTCGGT
CGCGATACAAGAAATACATCTATTACATCCAGCAAGGTCGTCGGCCAGATCTGCAGCTCGGCAAGTTCTCGTGGTTCATCGGCAAGAAGGTCGATCCGTG
GCGACTTCAGGAAGCCTTGAAGTGAGAGATTGTTGATCTCCGCATCTCGCTATTTCATTGCCGCTAATAGTGCATGGTATTGCAGCTTCCTGGTCGGATC
CCACGACTTTCGGCCGTTCTCGCAGGGTCTGCAGAAGGCGGAGCACGCGGGAAAGTCGACCGTGCGGACGATCTTGTCGGTGCAAGTCGTTGTGCGAAAG
TAGTCACCGAGCGTTTTTCCTTTTACCATGTCGAGGCGACTTTCTCACGATTTGTGCTGTAACCTCGCCAAGGAATGTGGTGTTTTCGCTCGACCCGCAA
GAGTGCGGCAGTGGAGAGATCGTCAATCCAGTCGATGTAGACGAGCGATATCGGGACGCGACTGCAGACGCCGTCCCGTCGGCAGACCACAAGAAACGCA
AAGTGGAGCGAGCGGCGGAGCAACCGACGTATCCCATCTATTTCATCTGCGTCGAGCTAGTCGCGAACGGGTTTCTCCGCCACATGGTGCGCCGGATCAT
CGGCACTCTGCGTCCAATTGGAGAAGGCACCCATCCCGTCAATAGAGTCCAAGATGTGCTGAATGGCACCGTCGAACCAGGTCCGTCCGCTCCAACCAAA
GGTCTCTGGCTCCACCGCACGTGGCTGACAGAAGAGGACTGGGTCGCCGACCATCCATCCACGTAAGAAACACTATAGCTCTTCGTGTCCAACAGCAGCT
TCGTCTTTGTCGACCTCTTTCTTGTCTTGGGCTCGCACGAGCGCCAGAATCCGCGTAATATGGTCGAAGATGAGCTCGCCAATGACCTCGGGCGAGTACT
TGTCCAGCATGTCTTGGCGCGCCTGTTTACCCTTTGCAATAGCCTCCTACACAACGCGAAAGTCAGAAACCCGTGACCAATTCAGATCAAATAGCCACCT
CGGCAGTGCTCTGTACCTCTGGATGGAGTTTCACTTGCTGGAGCAGCTTCTGCAAGTGCTCCACGGACGGATCAGCCCACCGATGTCCTCGAAACGCACC
GTCCGGTATCTGAAACGATGGCAACGTCGAAGCCCAAAAATTGTTAGCGCCGAGATCTCCACGGATTAAGGAATGCAACACAGCTCCAACCTCAACGAGG
CCGTTAATCTCCAGCGGATACGAGTTCTCTGGCGTCATGTACTCTGTGGTGCCGCTCCAGAATGTCGCAATGACCGGCAGCTCCATCGCCATTGCCTCGA
CATGTGGGCGACCCCAACCTTCTCCCCTGGACGGCAGCACAAACGCCGTAGCCGCTTTATACAGTGATGGCATGGCGTCTTGCGGAATGTGAGGAGGAAG
CACGTGCACTCGTGGGAGCTCGCTCAACTTCTTGCCCAGCGTCGACATCGTGAACTTTTCGATCACTTGCGTGAAATCGCCGGCCGAATCAAAGGCTTCG
TGGTACGCGTTCGTGAGCAATACGAGCACCACGTCGTCACCACGCTCAAATGCCTTGAAATACGCTTCAAGCAGCACTTGCCAGCCTTTGCGCCTCTCCC
ATTTGAAGATCGAAAGGAAGACGGTGGTCTTGTCTGTCAGCTCAAAGTCCACCTCGCTGGCAAGATCATACGGCGCCTCAACTGCGTTCGGGTCAAAGAA
CTGAATGTCTACCGCTTCTGGAACGATCTTGATCATCTCAGGACGGACACCACCAGCCTTAAACACATCCTCTTGGAACCTGCAGGACCAATCAGGTTAG
CTCTCGCTGACAACACATACAAGGCCACGCTCAGCACCTGGTAGGCACCCATATCTCGTCCAACTTGTTCATGCGGTCAGCCCATCCCGACGGCACCCGG
TCCGTCTCGAACATGGTGCGGCCCACTCGGTACCTGGCCTCGCGAGGTGGGCATCGCGTTGTGCGGTAGTGCGGCGGGTGCCACGCCCCAGGCTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGATGGCGATCGCAATCTTCATGCCCTTGAGACTCCATTCGAAGTCGCGCTCTTCAACCCAGTGCT