Description :
From Genome Similarity Track
Location :
Scaffold_91:31700- 35621
Sequence
3921 bases(100 bases per row)
CACAATTCAGATAGGTTTGCCGCCCAGGATGGATCGCTGTCCCTTCCTTTGTACCAGGTTTTGCCTATATATCAAATATCGGCTCACTCGTATTAACCGA
TCATTGATAATTATTTCAGTTCTTCCAAAACAATTTCGCACTCCCAACTATCCCCTAGTAGCGAGGATTGGTCAAAATAGATTTGATCTGCCTCATCCAC
ATTATACCAACTTGTACGACACTTTGGGACAACCTTGGTTTAATTAAGATTTATAATATTCACCTATGGAAATAGTCGGTAGTGCGTCGTCACACTTATT
GGCTACGCAAAACGGTCCATGTCACCTATGAGCGATATTTCGATCGTATCCCTCCTAGCCGCGATCCAAATACAGCCAAACCTTTGTTTTGGAGCCTATA
TACAGAAAGTCTTGATCCTCTTTATGGCTATCCTCTCTATCCTGGATAGCTAGCTTAAGTCGTCCTTTTCACCACCCTTACACGCTGATACTAGCTCTGT
ATTCCGTAATGCCATCCCCGTAAGTTTCGATTACGAGTTTCGGTGCTTCTTAATAGTAGGTTTTCTTCTAAAGTCGATAGTGGGCCTTAATCGTGAGTCA
AGTAAAACAGCTTATCTACACAGACTCGATCCTGCGTATTGCTAATTGCATACGTCAATCTTCTGCTATAAATTAAAAGATATGATTAAAATTTAAATTC
TAAATTGACCTATTGTTAAATCGTATTCGTCCCAGTCCTTTTGGTTTTCATCCATACATACATCTTGATCTATCGAGTCAACGACAGCAGCATACATTCC
ATTACAATATTGGCTTGCGGCCTATACACCATGGTGTCCCGAGTCTTTGTACCGCAATCGGATTAAATTCCAGTAAACCCGGACATAAACTCTGGCTCTA
CAATGTGGCGTATTGCCTTACTTGACCTAAACCGCACGAATACACATTTCTCATAGCTGTCTGCAATAGTTGGTGTAGTTTCGACGAACTTGCTTTCGCG
ATCACGTAACCAGAAAATAATAACCTACAATAAAGTTTTTTATTCTTTATAGAATCATAACAGCGAAGTAATGTGATCCATAGCCAAAACTAAAAAAGTA
CATCGCTTGTGAATTACTAGACCACCGGCCTTGACTGTATGGTCGTCTTTTTCCTGTTTCAAAATTAACTCATTCTCCCACCACTCGCCAATGAAAATTT
CCTCAGACCCGCTGATAAGTTCAGCCTTTCCCTTGGTGGCCACCGTCCAGACTTGCATGGTAGTAGTGCTGTATCGGTAGCATCAAGACAAACATCAATG
GAACTACCTCAGTACGATCTTTCTATCGAGTGGATGACCTCGGAGGGTAAGTTAGCAATCCACTTTGATCTACTTCATAATCAGGTGGTATATGGGCGCA
GGCCTTTGCCTTTGCATCCCAAAGCCTAGCCTCATCTTAATTCTTATATATCTTCAGGTTAGAGATTGAGATCGATTTATCTTTCGTTGATTGATTCGAT
CGATATGTACGTGCAGCACGACCCCTTCTAATCTATCGGTCTGAAAACGTCTTCTCCTGGTGGACCGAATGGCAGCAGCAACGTTAATCGATCTACTCGT
TTTGGCCGTAGTAAATTACTTAAACGATAAAGTGTGATCAGGCCGTGAAGAATTAAATCAGAGACCACAATCATTCCCTTTTCTAGCTGTAAGGCTTCAC
ATTTAAGCCGATCCGCACTCTTATTTCAGTCCCGCTACATGTATTGGAAATCACTGTGCGGTCACGATCGGAGTCGCTTCATAGCTTTTCGCTGTATTAA
TTGCAGCCCATTTCTTTGCAGTCTATCTCCCCTTTCATTTGATATTCCACTACATTTAATCCTCCGCAAATAATCACCCGTCGCCTGGTATTGTCATCGA
GCAAATCGACGGTGAGGAGCAACCTCGGTACTCTGCTGTATTGTGAGATAAGGGGTAAACTCAGAAAAATAATCTACAGTCCTCCATGGCAATTTTCATA
TGATCGCGCTGTATTCCCCACTAATTCTTTTCATTCTAGCTGATCTATCGAACCGTCTACTAGGAGGCTTTCTTCTGCGCTGACTTCAGGTGGTAGGTTA
CCGATCGTCTGACTTCTCTGCTTAAGTAAGGCGGTTGCGATCAACTTTTCATTACTTCTTTACGAGGTGTTATACTCGCAGCCAGCGTATCGATTATCGC
ATCTTCCCCCTTTTCAGATTGGCAGATGTATAGCATCCAGATTGACAGAAAGGTAGAAATCTTGTCAAATTTTCGTTTAGGTTCAAAGTCTGTAATAATC
ATGCTATCGTCGAGTATTGCGCAAGAACTGTAATCTCGCATGACATTAGCACAGTATAAATAATATATAATATCCGAATGAGGGATATTACCTCTTTCTC
GACCATACCAAAATTAAATCCCTTAGGCTGTATTGTACAGATAGAGCAATTGAAAGGCCAATGTACAACATCATGTTCTTGAAGTAAGGCAGCCAATACT
TTAAGTTACTGACATGTACCACAATCACCGGCGATCGATCTTAATCAAAGTGCTTCAATACTAGCATTGTAGCTACCTTAGCTTCAAGTATTGTGAAGAC
GCTCCCCGCATTACCCTAACGTCATCTGCCTTGAAATTTCTGATATCTCCCATCGGTTTAGTCTTGACCGTGTCTGTATTCTCTTTTAGGATCGTGATCG
CGATCCGGTCTGGGGTCAAGTATAGACATTTGTGCGTCACTTGTGCGGCTGATTTTAAGGACATCTTCATAACGCATTTCATACAGCACGGACGCATATA
TCTCGAAGTCCTTATTAAATATACTGCAGTATTTAGACTTTCCAGAAATGACTGCATTGATCTCAGCGTTGAAGAAATGAAATGTAACCAGCGTTCTTGA
TTCATTCAAATTTGCTTCCGAACCTTCCAGCGTGACTTTATGGCCCACGTATTCCACCCTATGGCGACCTCAGAATCGGTTGGCTAAGCTGATCAATAGA
TTTTACTCACGACAAAGTGATGTCATTGTTGTTTGTATTCAATAAGTGGAATATATTTGGATAAGGAATCCCACGACGTATCAGGCATGAGTATATCGTC
GATTTATGATCTCCGAACCAATACCGATGGTCTCGGATTGCGTCCGATTCACCTTCAGCGAAAACATAGATAGCCTTTGACGATCCAGCAGTGATCGACT
TATTTTCTGCACCATTTATGAATATCCATACAGATCGTTATCGATCCAGCGCTGATAAATATGCGACGCGTTCTAAAAATTAAAAGGCAACTATCCACTT
GAACAAACCTTACGGTGTGATAAATGCGGGAGATCAATTTTGGCCGTTCTTTCATCTTAACCACCCAAACCCACTCGTCATACTAAGGGACCATTACCAC
AGATATTTATCTAATCTTGCAATAATGTCACAAGTCAGAGGCATACATCACACCATCGATCGTGTCGACAGGTTCACTCAATTATAAGTAGTACACATCA
TTATGTCTTCGCCATATTTCTTGATTTTTTTCATCACCACGACCGGCAAATCCTACTGTGAGGAGGGTGGCTGAATGTTATTGGCCTATTATAACTCTTT
AATTAGATCGACAAGTTTTCTTAAAACTTAGGTGTTATAGGCCATACCCTTTGCGCATCCGGTTCTGCCCCTCTTACATCTATATCACAAAGTACCCCAC
GCGTTGCAGGAGGTAATGCGTCCATTTTTTCAATAAGTAAATGGCTATTCGTTTAAATTAATTATCGCAACTTTTCTTGATCGTCTGTCTTTTAGGCGTC
TGGGCTGACAACTTCAATTTATCAATCCTTATTTCTTTCTTAGGAGTTACAACTTCTGGTATTACCGCTATATGCCAATCGACATATTCAGCGAACAAAT
CACCGCCGTCATGATAATACA