Description :
From Genome Similarity Track
Location :
Scaffold_55:3170- 6069
Transcript NameFunction/comments
g6433.t1hypothetical protein

Sequence
2899 bases(100 bases per row)
GTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAAT
GGCTCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAAGAGAACTAATGAACCAACTTTGA
ATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACAGCTTGTCG
ACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTT
AAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTTGTCGTCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTCGTATCAGCGT
GCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGTACCGAGTATGCTCGGTACGCGTGGGTGCCTCATGGCATT
CACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAG
CTCTTCATGGTGTCAAACCAGCACGCGGTTGACACGTTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGTTTGTTGTCTTGCGGAAGACCAAAA
ACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCT
CGCAAGCACGACCGTACTTGCGTACCCATTTGTACTGGTGACTTCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGA
TGTCGGGGCATCGTGGTACTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGC
AGCAGATCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGCAGTACTCCAACA
ACTGCTTCGCATCCGCATCATGCGCGTATGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGTCAACTGCGTTGGCGTC
GGCCTCTTGCACCGCATAATCGGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTACTCAGCAAAG
AATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAA
GTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGGGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTT
GTAGTAAACCACACGATCATGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCT
TGGTCGGTCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTCTT
TAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTT
GAAGGCGTAGGCCATTCATTGATCAGTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCC
CGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCA
ATTCACAGCCCGGCTGTGAATGAACACGTCGTCAAAATAGCTCGGTGCGCGACTTCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCT
GGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGTATATCGCTCTCACGCATGAGGA
TCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGACGATAGTACTCGAGGTCATCGAATCGATGGTCACATCTTTTCGAGGTATCGGCGTTTGCGCCGG
TACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCATCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGAT
TCCCGCACTTGTCCTGCCTTACGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCGACGCAATACTTCGTTCCCGGCAC
GAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACCCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGG