Description :
From Genome Similarity Track
Location :
Scaffold_620:317- 4444
Sequence
4127 bases(100 bases per row)
CGCGGAGTCTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGT
GACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGACCGGAGCGAGCGCGAAGTCC
GACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGG
TTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGT
CTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCG
GCTTCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAA
TTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAAAAAACCGCAAGGTTGTTCGTCGATGGCGT
GTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGT
CTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGTAGTGTGTGCGCGGCAGCGC
CACGTACGTGGTCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGGCGTTCTACTTGAACGGCTTCCG
CCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTG
AGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGGACATTGTCAGCAGGGTCCGCGATGCCATGGCACCGGCCCAAGATAAAC
AAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGTGACCTACCTCTAGACACTGT
TAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCA
ATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGACCCAGCTCCTCGAA
GCGAGGGCCAGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCT
CCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGAC
GTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTC
TCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATC
TCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCG
AGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCG
GGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGC
AATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGT
GAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTG
GGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACCCCATGTG
GGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGAGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAA
TGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTTAACAAGGGCTCGTTCATAGATGCCCCTAGAAGT
GTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCA
GCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGG
GCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTC
CTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGA
CGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGACCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGA
TCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCTCTCCCACAGAGCCCGCAGGAGCATCCGGAGTGC
TCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCG
CCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGC
TTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGA
CCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAA
TGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGG
TTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTT
AAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTATACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTC
ACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTAAACTACCGTTCACTGAGAGTTTGTCTACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGT
GACCCCGTCACAGGACCCAACTCCAAT