Description :
From Genome Similarity Track
Location :
Scaffold_10:317- 2541
Sequence
2224 bases(100 bases per row)
GGTCAGAGCCCGAGATCAGCTACTGACCTGTTCGCTCCCCACTCTAGTGGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGG
CACATGATGTGCCCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAGCCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTT
TACTTCACCAAGTTCTGGGTACGATTCTGGCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCTGGAG
GAGGCCTTGCCTCAGCTGGGCTCTCGCGGAGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACGACGCCGGCGTCCACGACGCGAACGTTCACC
GCCATCGGTCGATCTCGAAGACATGATCCACCTTGTGGATAGGTTGAAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGCTGCT
CGGCTGAACGTTCAGCTTGCCTTGCTCCTGCATCTTGAGCACTTTGCTCCGCGACCTGTGGCTCTGCCACATGCTGTTGATCAGCCATCAGTGGATCCAC
CACTTGCTGTCGTTCAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGCCCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGA
GCAGGGTCTTGGTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCA
CGACCTTGAACGGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGAC
ACCGACCTCAAACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATT
ACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTG
AGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGCTAGCCAAGCCGTTCACGTAGAACGGCGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAAGGC
GAACTCAATGAGTGGGAGCATCTGGCACCAGCTTTTCGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGA
CCATCAGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTAAAGCGCGGGTCTCGAT
CCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAAACAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTA
AATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTG
CCAACATCCCTTGAGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCA
ACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCACCCACGGGCGTATCATGAACCTCAT
AGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTA
TCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCT
TGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACATCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTA
CATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGATTATTATGACGACTGTGTCGC
AGTGCGTAACGACGCATGATCAGT