Description :
From Genome Similarity Track
Location :
Scaffold_3263:317- 1770
Sequence
1453 bases(100 bases per row)
GCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACC
CTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAAAGCATAAATGC
AGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCT
GGATCAAACCATTGGCGGATCTGGTTGTAGAATTCATCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGAT
CCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTG
TGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATTCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCG
TTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGA
CACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCG
CAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAGATGAATCACGTGG
TGTCCCCGCCAATAACCTCTGGAATCTCCCAATTCTTGGAATCTCAAACTTGGCCCGTTAAAACGCGCCACACTTAGTCCAATGTAAGTATTCCCAACGC
GGATTTCATCTCGCATCTGCGCGCGAGCCATGTGTAGTATTGTCGTGTCCACCGCAACACTCCTTATATCTCACAGTTATTGGTTCTGGAAACTGCGCCC
AACCAATCTGGCCACTTGTTCCTGGTTGAATCTGCCCAGACTGCCGCATATACCATTTGCTGGCTGGTCCGCTAGCAGATTCGCAAAGTCAGACACTTCT
CAGCATCGACGCTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGT
CCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAG
ATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCT