Description :
From Genome Similarity Track
Location :
Scaffold_5290:317- 1318
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5290-fgenesh-gene-0.0Ubiquitin carboxyl-terminal hydrolase

Sequence
1001 bases(100 bases per row)
GTTGCTTTTCAATGAGCGGCGCCAACTGCTTCTTCTCGGCGAGCGTCTTGAGCAGCTGCACAATAAACGGAATGTAGTTGTGCTTGCGGCGCGCGTTCTC
CAGGGCCCAGTTCTTGCGCTTGGCTTCTTCGTTCGTGATCTCGCGCTGCGCGTGCTCGAGCTCGGCGACGACCGACGGCGTCTGCTCCTTCTCGAGCAGC
TCATTGATCTTATCCTGCTGGATCTCTATTCTATTGCGGATGAGCGCGAGCAGGTTGAAGCGGATCTCGGACGCAGAGTACTTTTCAATGCGCTGCTGGA
TCACGGGGCATGCGACGCGCAGCCAGCTCTCGCGGTCGCTTTCGTCGGGCACGGCGCCGAGTAGCACAGGCCCGGGCTTGAGCCCGTCGAGCTCATAGAC
CTGTCCGTTCACGGGCACGTACGCGATGAAATGGTACACGTCATCGTCGCTCGACGACGCCTTGCGCTCGTCCATGACAAACGGCTCAGCACGCGAGAAC
GAGTTGTGCGCGAGCCGGATCGTGTCGCTGTTGGAGATGGCGTCGCCCTTCAAATCGGACGGAAAGTCGCTCGTAAAGGTCTTGAAGTCGCGCAGCGTGT
CGCCCAAGTCGATCTCGGGGCGGTTCATGAGGATGGAGAGAATGGCCTGCGTCGCGCACGCATTGTTGATGGTCTGCTTGGCGAAGAAGACGCTGTCGTC
GGACGTGTACTGCACCGACTCGCTGTGCTGCGCGTGGGCGGCCTCCCACTTGAAGAGAAAGATGAGCCCGTACACGGGCGCGAGCTCGGCAAAGAGCGCG
TCGTCCAGCGCGTACAGCTCTTCGACCTGCACGCCTTTGACGCCAATGTCTTCGATGAGCGCCGTGAAGACACCTATAGAACGGGGGGAATACGCCGCCG
TTTAGCGTCGGAAAGACCGCAACAGAGAGAGGGAATGAAGGGCTACATAGGGGGGACACGTACCAGGGTCGGATTCGATCGTACACCACGACATTGTCGT
G