Description :
From Genome Similarity Track
Location :
contig_47:316985- 320663
Transcript NameFunction/comments
g7884.t1hypothetical protein PHYSODRAFT_285506

Sequence
3678 bases(100 bases per row)
ATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGTCCGGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCGACTGGT
ACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCACAATCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGCTAATAT
TTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGGGGTTCGCTGCTGCTGTGTGTGGGCTCATTCACCAACATGAAGTCGCAGGACATGAACACGACGC
AGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCCTCGTGTCCGCCTACATGGGCAATATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGACGGCGGA
TGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTATCCATCAGGGGGAGTGCTGTAAGAATGGAAAGAACCGAACTGTTTGATGGTGTTTTTGCTTTTTG
CTACAGCTCTGAAGGATGAGGGTAACGACTGCTGCTATTTCTGAGGACTAACGGAGTGTCATGATTCCTGCGACTGTTGCTGCCAGAAAATGACGATTGG
TCTGCGCGAGGTTAGTCCTGAGAGTTTTGGAGAGGAAGCAGCTCGGACGAAGGATCCCCCTCGTGGAGATGGGTACCAGCATGCTGGTCAAGAAGCTGGC
AGTGGTCAGCCCCAGAAGATGATGAAGCGGCCGCGAGGACCGCCGCCAGCCAAGATACTCATGACGTCGACTACCCCAGCAGCTCGGTTTTTGCCACCTA
TTAGGCCAGCAAGTCCTAGCACCCTTGGCCCAGCTTCTTTGATGATGACTCTGGAGGAAAAACAGCAGCGACAGATGCACTCGTTCCTGCGCAACTTTCT
CGATCCAGGTGAAAGTGGTCGTTTCCAGCAAGTAATTGACCTCCATCAGCATGGAATTGACACGGGCATTACTGTCACTGACGCGACGCTACAGGAAGTG
GTGCTCACTGTGCCGAATCTCCGCGGGCTGAATCTATCCGGCTGCTGTCACATCACTGATGCGGGGCTTTGGGCCGTGGCCAGACACTGCCAAGCCCAGC
TAGATACTATCTACCTGGCTCAGTGCGAGCGAGTGACAGAGCTCGGGCTGCGTCTTCTCGCTCATAACTGCAGACTTGTGCTGGTGGACCTCAGTGACTG
CCCGCAGCTCAATGATGCCGCGTTGCAAACGTTAGCCGCTGGCTGCTGGATGATTGAGACTTTCATAATGAAGCGGTGTCGAGGTGTTTCCGACGCCGGT
ATCGTCAAAATTGCTCAGTGCTGCAAAGACTTGCGCCATTTGGATGTGTCTGAGTGTTCTCGGCTCGGTGAATACGGCGACAAAGCGCTCCTTGAAATCG
GAAAGTGCTGCCCGAAGTTACTTGTGCTGGATCTCTTCGGCTGCCAGCACGTGCATGACCCTGGAGTTCGCGCTATCGCGAAAGGCTGCCCATTATTAAC
GACACTCAAACTCACTGGATGTCGGGATGTCAGCAGCATAGCCATCCGGGCATTAGCTCAGCAGTGCACACAGCTCGAGGTCCTCTCACTCTCAGGGTGC
ATCAAAACGACGAATAGTGACCTTCAGCTCCTTGCGACTAACTGCCCGCAACTCACCTGGCTAGACATCAGCGGCAGCCCGAATATTGACGCGCGAGGTG
TACGCGCATTGGCACAGAACTGCACTTCTTTGACGTATCTCAGCCTGGCTCTGTGTCAACGCGTTGGGGATGCGGCATTGGGCGAGCTTGCCAGTGCAGG
AACTGGAGGTCTCGCCAAGTCTCTAGCGGAGTTGTCGTTAGCAGAGTGCCCTCGCGTCACGGAAAACGGCGTCAACGCACTTACTGCCGTGTGCACCAAC
CTTATCACTCTAAATCTCACCAACTGCAGACAAATCGGCCGAAGGTTCCTTCAGAGACTTATTAACAAGCTTGAATTCGTGCAATGGGCCACCAGTTTCT
TCGGCTACGAGCCGTTGCCGAATGCCGCAGAGCTGTGCCGTCAGCGCGACCTCCGTTTGTTGCAGCTTCGGAGTGCCATCAAAATCCAGTCGGCGATACG
TGGATGCCTTGCACGTGGTGGACTTTGGCAAGCGAAACTCAAATTTGTGGAGCGAAAAATTCTACCCAAGATCCAAGCGCGTGTGCGAGGGTTCTTGCTA
AGGAAGAGCTTGGCAGCGGAAAAGCAGTATCAACTAGAGGAGCATGCTGCTCGCTCAATTGGGCGTGCATATCGCGACTTGCAGCTTCGACGCATGTTGG
TGCGTGCGAAGCGCTTGCGGCAAATCAAGGAGCATGAAGATGAGGCTGCTCTCATTTTCCAGAAGATTTTCCGAGGGTATCGTGACCGAAAACTTTTGGC
CAAGATGAGGTATGATATCTACTGCGAGCAGCAACTCCAAGCTCGTGTTCTGGTGATGCGAAATTTGGCAGCCACAAAGTTGCAACGTGCGTACCGAGGA
CATCGCGGGCGGTCCGATGTTGCCATGTTGCGCTCAATCAAGGAAGCAAAGCGTCTTCAGCACGAGAAAGAAATTCGCTCAGCATCTTTTATCCAACGTG
TATATCGAGGCCACAAAGGACGCACGGTTCGTGCTCAGCGCCTTGCAGAATTACTTCATCAGCAACAATGCGACCAAGGAGCCATCAAAATGCAAAAGGT
GTTCCGTGGCCATCGAGCACGACGGAATGCAGTACTGTTGCGTACTGAAGCGAGTGAGTTACGGATACTTAACGCCGCCTTGACTATTCAAAGATACTGG
CGAGGAATCCGCGATAAGCATTTGGCCGCGGTGTTGATTGGGTTAGTCAAGCTGCGTGCCAGGGAAAACGAGGCTGCCTACTCGATCCAAGCTGCTTATC
GTATACATGCCTCCCGAGGATTCATGAAGGCGATGAAGCTGGCTTTGGCAGCGCAGCTGAGAAGAGTGAAAGCAGCTACCGATATTCAACGTCTCACACG
TGGACATCGTGGACGGGCAGAGGCTGAGCTTCGGAGGGAGTTGCAACGATTCCGTCACCAAGCTAAACCGTTATTCGCGAAAGAAGCACGTTTACAAGCA
CTTGTGCATGACCTGAACGAGAAAGTGGAACAGCTACAACGTAAACTCACTGCTGATGAAGAAGAAGAGCGTGCTCTCACGCTTGAACTCGAGAAACGCT
ACAGATCAGAACAAAGTACCATGACTCGAGTCGTATCACGGGCACACCCCAACGCTATCTGACGCAGTATCTGCAAGTACAGCTTGCCGATCAGCTACGG
GCAAAGCGAACTGAGATCGCCCTTGATGAACGGGCTTTTGAAACCTTAACGACAAATCTGAATGACGCTCAAAAGCAATTGCGGGGCGTTAGGCGGGAGC
TGGAGCCGCTAACGGAAGGTGTTATCAAGAAAACACGTGAAAACCGCGTGAAGAGGTTGCAGGATAAAGTTCGCCATGAACGTCGAGCGGCAACTACTAT
CCAAAAGGTCTTTCGTGGCTTTCGCGTGAGGTCAGCGGTTCGAGAAGGTGGAAATTGCTGGACGCAAATGGTTTCACCTGACAATGCGCGACCATATTTC
TATAATGCACTGACAGGAGCGACAAGGTGGCATCGTCCTTTAGCAATGGACATCTTCGGAGGCCAACTTGCAGAGCCC