Description :
From Genome Similarity Track
Location :
Scaffold_69:31696- 33117
Transcript NameFunction/comments
Albla_Nc14054960

Sequence
1421 bases(100 bases per row)
TCTATGGATAAACTTCGAATGGACAACAACCCTGTCTATTCTCTCCAGCTTGAGTTCGCCGACATATTTCCGGACGCAATCCCCGAGAAATTGCCCCAAA
GCTCGTGGTATTCGGCATGAAATCGACCTCATGCCGGGCACAAAGTACTGTGTCACGCGGCAATGGCCACTACTGCGTGATCAGGTGGAGGCAATTGACT
CCTACTTTGCGAAGCGTCAGAAAGCAGGTCATGTGCGTAAAAGCATCTCACCAAATTCCTCTCCGACCTTTTGCTTCAAAAAGGAGCCAGGTGGATGGCG
TATTGTTCACGCTTTTTATAAACTCAACGATGCGACCATACCAGGTAAAACACCAATACCAATGAAAGATATAGTATTGAACACAATGTCAGGGTACACT
ATTCAGCGCCATTGATTTAACGGACGGATTCTACAAATTCTAATGCAACACCGCGATATCCCGCTCACAGCAGTTAGCACACCTAGCGGGATGCTATGGG
AATGGCTATTCACGTCAGAGGGGCTTAAGAACGCCCCTGCGGCCTTCAATCGAATGGTCTCTCATGTTCTCCGACCATTTCGTGATTCGCACCAACTTAT
TTCGATGATATCTTCGTGCATAGCAAGCGTAGTGACACGAAGTCTACTGTGGCAGTCCATTTGAACCACCTGAAACAAGTATTACATGTGATGAGAGACA
ACAAGTTGTACGCCAACTTAAAAGTGCTTTTTGTGCGCCCGAGATCCCGTACTCGGATGTTATGTTGGACAGAACGTTGTGCGACCCGATACAGAGAAAA
TCTCGTCTACCTGCTTCTGGCCGATTTCAACTAATTAAAAAGAACTTCGCCCGTGGCTTGTACTGGCGGATTACCTTCACAAGTACACACGAGATTCTGC
ATGCTTATTCCGTCCCCTCTCCCAGCTGCTAAAGAAATATATCGAGTCGTCATGGGAAACGGAACATCAGGAGGCTTTCGATTTGATAAAGAACATGTCC
GAGGCCCGAATACTCATTTTACCAAACTACTCTAAACCATTTCATGTGGTTTGCGACGCCAGCCAATTCGCAATTGGCTGTGCTCTCATGCAATTTGGCG
ATGAAGAGAAGGAGAGGGTAATCATCTACCAATCACGGCACTTGAAGCCAGCCGAACGGAACTACCCCGTTCATGATAAAGAATTGCTCTTAATGCGCTA
TGCGTTGATCAAGTTCAGAGTCTATTTGTTGTTGGAACAAAACTTTATTATCTACACCGATCACGCTTCGTTGCTGTTCGCAACGAAGAGTCCCCACCTG
TCGCAAAAGATGGCGAGGTGGCTATCCTTCTTCTCAGAATATAACTTCGTGGTTTACCACAGACCAGTGAAGAAGAATATCTTCGCCGATGCTTCATATC
TCCGCCAAGATTATGACTCGA