Description :
From Genome Similarity Track
Location :
contig_50:31695- 34568
Transcript NameFunction/comments
g9891.t1hypothetical protein

Sequence
2873 bases(100 bases per row)
GACAAGCCAACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAATTTTCAGAGTGCTTGGATTTTGCAACCCCTTGTTAGCCATCGATTCAACACCTCCA
TCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCCTGGTCGAACGTTTTCACGTAGGTGAGCCACGTCTTGAACAGTGGAT
TGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAGACTTCATCGGGAGATTTGTTGCTGGCGAGATAGCTCTGGATCTGATAAGTATA
TAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACGGAAGCCTTAAATGACTAAACGCTGCCCAGCGTAGTA
CAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGTATAAAATCCAACCGATGGTCTGTCCCTTCCAAATGA
AACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAAGCGGATAGTTGCCAGCACCGGTACCCTCGACCACAT
TAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTAGAC
AGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATCGAT
AGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTCATGCATACCAAG
AGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATAGTACCATATCCT
TTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAGGAAACTTGTTGT
TGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCATCGG
GCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAACCGGCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACCGCAG
ACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAACACT
TCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGATGAA
ACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATT
CCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAATGGCACTTCACCGAGCTTG
TGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGAGTATCGGAAA
TTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTCGACC
CTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAACGCGCACCACTCTCAATTAGAG
AGAAACTATCAAATACTATAGTCAGTCGATACACACAGCAAAACTATCACTTCGGGGACAACTGCTAGTCAGTCACCTCGAATAGCAAGGGAATATGAAA
TGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCACCACCTAACTGGACTTGA
TGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCGTCGG
CAGGCTTGGCCGAATTCACTTGCGCAGTACGGGTAAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAATTCTTTCTAGATCTCGGCTCTGGG
TGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGTGTCGACTCGACAG
TTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACCATCAAGATTCTGG
TATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACTTGGGTGTTGGTAGT
GGATGATCTTGGTTCAGTATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTTCCGCCAGGCTTTA
GGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGATTTGTACACATCCA