Description :
From Genome Similarity Track
Location :
contig_50:31694- 34566
Sequence
2872 bases(100 bases per row)
TTTTGCAACCCTTGTTAGCCATCGATTCAACACCTCCATCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCTGGTCGAAC
GTTTTCACGTAGGTGAGCCACGTCTTGAACAGTGGATTGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAACTTCATCGGGAGATTT
GTTGCTGGCGAGATAGCTCTGGATCTGATAAGTATATAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACG
GAAGCCTTAAATGACTAAACGCTGCCCAGCGTAGTACAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGT
ATAAAATCCAACCGATGGTCTGTCCCTTCCAAATGAAACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAA
GCGGATAGTTGCCAGCACCGGTACCCTCGACCACATTAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCAT
TTCACGTCGTTGTCCGTACTTGAATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTT
CACCCCATCCGCGATACCGTGCGCGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAAATTAGAGACTG
CTATTTAGATATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGG
TTTTGACAAGAGCGAAAATATAGTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAAATGAATGTCA
CTACTGGTCAGATGAATGGAGGAAATTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCC
CTCACCAACCAAGAGTATTGGTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAACCGGCCGCTCTCGCACCTGTGTGCG
GAGGGCTATCAAGACCGAGCGAGGACCGCAGACCTACAGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGAAGTGCGTGTGCTG
GTTCGCACGGCGGCGTCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTG
TGGACCATCTTGTGGCGAGGTCGATGAACCTTTACCGCCCAGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGAAGACTTG
TAGGAGTCAACAAGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTG
ACGAAACGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTG
GATTTCACACCCAGATTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAA
TAGCCGTCACTTATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTAT
AAACGCGCACCACTCTCAATTAGAGAGAAACTATCAAATACTATAGTCAATCGATACACACAGCAAAACTATCACTTCGGGGACAACTGCTAGTCAGTCA
CCTCGAATAGCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCT
TTGGTCACCACCTAACTGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGT
CTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGTAAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCA
ACTCTTTCTAGATCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGT
AGCTTCAAAAGTGTCGACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGT
CAGTGGTCAACCGTCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCC
AGCGCACGACTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAA
CTGCACTTTCCGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGATTTGTACACATCCAGGATA
CACACTTCCAGCCAGTTGGGCCCATCGTGGTTAGGCGTAAGATCTTTCCATAAATCAGTCGCACTCCATACG