Description :
From Genome Similarity Track
Location :
Scaffold_16:31685- 44877
Transcript NameFunction/comments
Phyra_94344GRAM domain containing protein
Phyra_4251860S ribosomal protein L7a-2
Phyra_76054Hypothetical protein
Phyra_94347Hypothetical protein
Phyra_76056callose synthase, putative

Sequence
13192 bases(100 bases per row)
GAATATGCGTTATGCGAAGATAGAAAGGGTTTGTCGCCAAGTCTGCGCGATCCACATCAATTTCCTCTTGACTACCAAGGCTTTGAAATCCTTTCTCGAT
GTCAGCTAATAAATACATGCAGTATACTTAATGTCAGTATCCACCATAAACGCTCCAAGCCTAGGCAACCAGTGTACTTACCCAACTCGTCAACGCTGTT
GGCACTCTCTTTCATCCGTTCAACGAATTGTTGTGACCGCGAAAACATGCCTACAAACGCCTTTTGCATCCGTACAAGAACATCTCGCAAATATTCCAGG
CGTTGTTCTTCCGTAAGCTGAAACGCGTGAAGATTCTCTTTGGTTTCCCGCTCGGAAATCAAGCGTTGTGCATTGGTGTACTCCACCGTTTGGACGTAGT
GTTTTTCTGCGGCAATGACTTCTTCAAGACAGCTGTACAATTTGGAGCGTTGCCGCTCCAACGGATTGCGGCCAAAGGCCGACGTGGTATCCCACATCTT
TGTCAATAATTGCCCTGCACCTGCCGCCAACTTGTCCGTCAGCTCCTTAGAGGACGAGACCTCATCAGACGAATCTGAACTATAATCCCCGGCATTTGGG
TTTTCACTCTTCCGCATGGATGTCGTGATCTCAATAGCTTCTTGGCATTTGCGTTCGTACTTCTCCCGAGCCTTGTCCATCGAAGTAGTCATTTGCTGCT
GAGCCCAGCGCACCTTGGTCCCCTCTTCAACACACGTTGCAATAAAAAACTACGTTAAAGACTTTAGGACGCCCCATGTGCAGGTACAGATCCACCAATT
GTTGCCACAACGAACCTGCAATCAACCGCTGCACCTGTATCTCCTGCTGCGCAGCAAATGCCTTTGCACCTGGTACAATAGCAGTCTGCATAGTCGACGC
GAATGCCCATCGCTCTTGGGCCAGATGCTCCATCGCCTCCTGGACAATAACCCAGCAGTCCGTAAGCTGCTCGGACCAGTCCTCGGCCTTCGCACTCCTG
CACACACACCAAACAAAAACAAAAAAACCAAGTTAAAACAGTTCAAAAACCGTTGCAGAAGCTGCCTCGTACTGCGCGAGCTTTAGCAGCGACTGAGCGT
AGCTGCACTCCAAGCCAGCACGCTCCGTCACAAACGCCGAGACTGCTTGGCAGAGCTGCACGCCGCTTTTGGCCTTCTGACAGACTTTCGGGAACGCCCG
GAAGAGGTCAGTGGAGTAGGTTTCTTGGGTCTGAGCCGGGTGGGGAGACGTCACAGAACCGTCATCACTCCTAGTAGTTGGGCTGGTGTTATCTGAAGTA
GAAGGCGGTTTGGAGGCGGTTGCGACGTTGCTGGGACTGCTCTGGGGCTTGTTCTCCGCTGGAACATCCGACAACGTGTCCACTTTGAGATCCGGCGCGT
CTTCTGTTGGCACCGAGAAGCCGAGGAGCAGGGAATTGCATACGTGAGTTAGTGGGGGGAAGGCAAGATGGAGGAGCGCAGGACGTACCCATGGCGGAGC
TTGGAGCACTGTGTCTTCGGTGCCGCACTTTTCACACTGAAGGGCGGACGAAAATGGACGGGCCGTTGAGCGAACTCGGCATACAAAACGCAAGTGAAAC
GTTAGGAAGTGTCACAGGATTCACCTGGATAACCTGCAGACAAATGCACCAGAAGGGATCTGGTCTTAAGCACGCGGCACTACCAAAGTTGGCGCACCTT
GGCATACATGTGTAAACGGATGAAATAATACTTAAGACGATACGATTTGGATGTTGAATGTTATTCAGCCATTATGAGAGCACCTACGAATGAAGAAGAG
TGCCTCGCCACGCCCTACTTCAAGCCAGAACACTACTTAGTACTGGGCCTTCTTGGCAGCCTCGGCAGCAACCGCCTTCTCGCGCAGCTCCAGCTTCTTC
TGGGTCTTCAGGCCCATGATGCCACCGCCCCACTTGCGACGGATCGTGTTGTCCTCGTTGAACTTGGCGTGGAAAGCCTCCGTGAGGGAGTCGAACTTGG
CCTTGTCCTCCTTGTTCACGTGCGTCAGCGCCACCACAGCAGCGTTCTTCTGGTGCACGAGCTGTCCCAGGCGCGACTTGCCCTTGACAATGCAGTACGG
GATGTCGAACTGACGGCACAGAGCAGGCAGGAACACCACGAGCTCAATGGGGTCCACGTCGTGGGCAATGACCACGAGCTTGGCCTTCTTGTTCTCGATC
AGCGAGGTCACGTGGTTAAGACCGAACTTGACGATGGCGGGCGGGGCCGAGGCCTCCTCCTTGCCGGCGGCAATGTTGCGCAGACGCAGGGTCTTGGCGG
CCTTCGTCTCCGGCTGGTACTTCAGCAGCAGCTTGAAGAGGTCCGTGGCCACGTTCTTCTCCACAGTGTTGGAGAACTGGTTGACCGACGGCGGCACCTT
GAGGCGCTGGTACAGGATCTTGCGCTGACGCTGCAGGCGAACGTAACGCGGCCAGCGCACGAAGCGGGACAGGTCACGCTTGGGCTGTAGAGATCAATGT
AAATAGAAAAAAAGAGAAAAGTCAGTACTACCGTCCTGTATACTGGGTGGAGATGCCTCCCCACGCCAGAAAACCAGTGAGCTTTGACAGCACGGCAGAG
AGCGAGGTTCTTTACCCTTGAGGCGCAACTCATCGCGAGCGAATGAGATTGCCACCACAAGTTTGTGTCATTGCGGTCGTGGGGGACCCGCTACACTGTT
CTCTAGTGAGACGGCGAGGGAAGGCAGAGGCCGAAGCTTCCGTCTCCTCAGCGCCGTCGTCACCGAGGGGCGTGGAATCGCAGCCAAAAGAGGCCAAGCG
ATTGGATGTGGAGCTGCGGCGCTTCAAAATACCTGAATGTCACCACCCTTGCGGAAGTTCTTGGGCGTGCTCACGAAGAGAGGGTTCTTCTTCGAGGCGC
CGGCCGAGGCCTTGACCGACTTGGTCGACGTGACCTTGGTGGTGGTGGTGGTGCGCTTGACCTTCTTGGTGGGCATGGTGATCGTAGATGGCGAATAAAC
GAATGTGGGAGCTCACCGGCAGGCGGCGAGTGCCGCACGCACCAGCCAGTCATTCAATATTGCGGCTTTTCATCCAATTAAAAGACGGATACATAATAAA
TGTGGACCACGTAGAGTAATATGGTGTCACTCATATGAAGGGATTTAGTGACACATGCAACTTGAAGTGAGCTTCAACACGAGAGGGCAGCTACGAGCCG
CCGGAAGACGCCGACACCGTGTTTAAGGACGCTGATTTTCCACTGTACGCTGCGGTGGAAGTAAAACGCGTCTTCTCGGCGTACGGGATGCGAAGTGACA
GCGCGTGCTGGTACATGGCGTTCTCCTGAATGGCGGTCAGTAGTACGTGCACGCCAGGTGCAGTGCCAAATTCCTACGCTGCGCAGTCTAACGTCACGTG
CTGCGGTAGAAAGCGGCTTATTCCGTCGCACATCAATCCACTAACAGCGTCAAAACCTTCAGCCAGCCCGCCGTCCTGGTCCCCAACTACTACCACGTCC
CGATCAGCGCATATGGTTTGGGCTCTCTGAGCAGCGCCGCGGCCTCCACCAGGATTCAACACCAGAGAATCCTGGCCTGGAGGACCTCCACCGCCGAAGT
ACACCGTCGTCGGATAATGGTAGTTCCCGCTAACGACAGCGCGCTTGCCTGCTACGAATCCTTTCGACACAATAGTCGATAGCATTCCAAACCAGACGTC
GAGCGACGTCTCCCAACTGACGGGTGTCTGCGAGTTAAGCACATCGCGAATATGATCGTACCCACTGGACCCCAGCGCCCGTAGCCGCTCAAAGTCTTCG
GGCCATAAGAAGTTACGGTTCAGGTCCACGTTGTTTTCATTAAAGCGACGAAGCCACATTCGGGAACACGAACAGCGATTAATCCAAGTCAGTCCAAGCA
GCAATCAGAGAGACAAAGTGTGTATGCTTCGAACAATCTTACCTTTGCAAAGTCGTACGGATTGAGTGCATGCACCATGATAATCGTTGGTGGATCCGAT
TTGCTACTTTCTCGTCGCCCAGATTCGCAAGAATTGATGACTGAATTGCGCTGCCTGCAAACCCCTCAACCCCGTGTGTATCGGAAATGTGAGGTACTGC
CTTATCGTTGGCTCCCTCGACAACGACGACATCAATCGTCAGATCCAAGTGCGCGTAGTCTGGGAGCGGTAGTGAGTACAGAGTCACGTCCTGCGGTGAG
TTTTTGTCGGCGTGAACTGCTCTGGAACGGAAGAGTGCGTGTGTATCGCAATAGGATGCGGAGAAATAGTTTTCCACTTCGGCGTCCACCTCGGTAGGTG
GGAAATACGTATCCAGCGGTGCGAAGTCGTTCAGCATGTGCACCCAAGCCGCGAGTGCTGTGGCAACAAGCGTCAGCCACAGCAATGTCATCCTGCCGAT
CTTTTTTGTGGCTTTTGACAACTATTTTGAATCCAAGCTTCACCCTGCGGTGTCGAGTGAACCAAAGTGCAGGGTCGAAATCATTCACTTCGAATTCGTA
TTTCCCCAATTAAGCAATTACTACCTGTCAGACTGGCAATTGTTGCCTGCGATAACTCCACAACCTTTCCCTTTTACAAGGACAGGTACCGGTGGAGCCG
ATCGTACACGTCCGCACCGCGACGTAGCACCTCACTCTTCCAGGAGCTGCTCTGATGCAGATAAAACACGTCTCGAAGCTTCTGCGCGTACGGCAATCGG
TTCACGGATGATGGGCTGTGGTGGTACATGGAGTTCTCTTCAATCATTGCCTTAAGAATAAAGACGCCTGGCACCGTCCCGAACTCTTGACAGAACAAGA
GCGTATTTCCTGTAGTTTGCGAGCCCAATAGATTCGCCACACCATCAAACGTGAAGCCGCCAACTCCATCGTAGCCACGCGACACGGGGTTTTCGTTATC
GTGCACAAATACCACCTTGTCCGCGTACTCCGGGCCAGTGAAGACACTGCGTGCGACGACCATATCGCTCCCCGCACCCAGCATTAGTGTATCGACACCT
GCAGGTCCAAGTCCCGTGTGCACGTCAACCATTGCGAACTTGGTAACAGCATCAAAGTCCACATGCTCGCGCAAGAACGCCTGCAGCAACGCCAAGCTAG
GCTCGAGCTGCGTTCCACCGTAGAAGATCGTATCCGAAAAGCGGTAGTTCCCACCAATAGTAGCCTGTTTGATGGTGTCAAAGCCCTTCGTAGCCAAATG
CATGATGGCTTTCACCCAAAACCAGTTCTTGACGCTGTGCAGATCCTTCGGGTTCAGTAGCTCGTAGACGTCCAGGTAGCCCAGCCGGTTCGGGTCTCTC
GCCTGCCGCTCCTCGAACTCCTCGGGCGTGAGCCAATTGCGGTTCAAATCCACGTTGTGCTCATTAAATCGACGCAACTGAGCGAACCCAAACGCATTGA
GCGCGTGTACAAATATCACCGTTGGCTTGAGTTTGTCGGTGTTCGCTCTAGCAACCGCTCGCTCCAGCAGCGCCGCCTGGATGGCGCTCCCAGCAAAGCC
CTCGACGCCGTGCGTGCCTGAAATGTGCAGCAGCACGCGCTCGCTCGAGCCTGGAAGCACCGCAACGTCTACAGTCAGGTCCAGCGGGCTTAGATGCTCG
AGAGGAAGCGAAAACAACTTGGCGTCGGCTGCCTTGGCGCGTGCGCGGAAGAGCGCTCGCGCCTCGTAGTACGAGTCGCTGAAATGAGCCTCGACGCTGG
CATTGATGCTGGAGGACGGAGTGTACGAGTCGAGAGGCACAAAGTCGTTGTAGGCGTGCAGCAGCAGCGCCCCCAGTAGCGTGGCCAGAGCAGGCAGCAC
AGCTCCGAGCATGGATAACAAGCCCCACACTATTACCGGTAAGTGAAACAAAGTAACTTGCATTTCGAAACCTGTTATACCTGTACTATGTGCGTTAACA
TTGTGTGACACACTTAGCGTATTATCAGAGCCCAGGGACGATCTGCCGTCGAAAATCGAGACGTGTCTCTTGCTGCGTCGCTGGGCAGCCTCAGTGCTTG
ATCGACGCCATGGGTCAGCACTGTTCGTGTCTGGAGCACCCACCCAAGTACCAGAGGCGGGAATCGGACGACATGGACACGGTGGACATAGAGAGAGGCG
ATGACGACGACCAGGAACTGGAGGTGCTGGTGGACCAGGCGCAGGAGACCCACGAGCTGCTCCGCTCCAGTCCCAGAGCGACTCCGGGCGGGCGGGACAG
CCTCCGTGGTGCCTTAAAGCGGACCGGATCCGTCGTCGCTGCAGGTTCCATGGGTGAAGACGAGAGGAGGGGAGACGAATACGAGGAGAAGGAGTCGGAA
GAGCAGCACATGCGACGCAGTCTCAGCACCGGACTGATGGGGCTAGATATGAACCACCAGCCGACACCATCGCTTCGACCCGAGGAGCTGTCAAGGCTAC
TGCGTTCTTATCAGGAGGTCACGGGCGTGGTAAGAGTTTGCTTTCAGAATGTTCCCATTCCGGTGCTCGTGCTGACCTCGGGTGGTATTGTCTACGGCAG
GTCGATGAAGGCCAGTTAGATCTCGAGTGCATCATGTGCCTGGACACATTCTCCGAGGTGAGGACAGCTTCGATGGTTTGCGTGCTGGGATACGAAGATT
GCTGACACAGATTGTATTTGTACAGGACAACCCGAAGGTCCGAACGCTGTGTAACTGCGGCATGAATCGCACCAATTTCCATATGAGCTGCTTGCTTGAG
TGGCTCAATCGCGACACCAATTGCCCAGTTTGTCGGGAGTATCTCTTCTTTGAGGACTGATACTCCGACACGATCGTCAAGGCCAGAATTTATTATGCTG
ACGACGTAATTCGTATTCCATCGTGAGAAGCCGAGATTGCCGACAACAGAACTTTTTCCATGCCACTGGCCAATCAGCGATGAAGGTACACAACGTGACT
GGCATCTTCTAGCAGAAGGCTAGTTCTTTTGACGCGCATCATGCTTATTCTTATTCCGTAGCAATAGTGTTTACAGTCGCCGCCACGCGACAATTTTGCT
TCAATGAGGCCATGACACGGCCCACAAGAGGACATAATGTCCTCATTAAATTCAATCTGTACTCTATTTCTTTGGCATTAGTCGATAAGATTTTGACTTT
AATCAGCGTCCTCGTGCTAGTTGTGTCATTGCTATCATTTTGCTCACGTCCTCATTCCAATCCGATCTCGAAAAGCATACGCAGACGCTATCGCTACGAT
GCCAATCGCGACAGCCGTGACAATGATAGAAGTCTGAGAGCGTAAAGATACAAATGATCAGTTCGACATCACCTGTGTTGTTAGTTGTAAACTAACCTGC
CAGCTCTTCAACATGTGATTCGATTTGTCTCCATTCCTGTGGAAAATAAAGATATTACATCAGTCACCACAACAATCAGTAGACGAATATTCATGATGAA
CTGAACACCGTTCTACCAACCTTGGCCGCCGAGGAGGTAGTGGTGGAACTTCCTTGAGCATTGGTGAAGTTGCACTAGGCCACGGTTGGTATTCAAAAGG
AAATTGGAAGTACATATTTGGGCTAGGTGGGAGCGCGCATGCACGAAATCCATGCCTTTGACGTTAGACACATCACAAACATTTGAACTTGGCAACGTAA
CGTACACTGCAGTAATGTCCACTTCACTTCGCCGTCGGAGTTGTTCTGGCGGCAACTGATGAAACAGCACAAGAGCACGTGCGATCACCTTCTCCACGTC
CATGGTAAGCGGCAAGTTCGACAGCATTCCGTGCATCGTGCCAAAGTCGCGCTCGCAGCGCAAAATCTTTTCCCTCGACTCGAGCACAACCTTCAAGCTT
GGTTAGTGACAAGCTAGACTCCCACAGCACTACGAATGAGAGGAAGCACTTACTGCAGCAGACACGTATAGACTGAAAAGCGGATGGGTCACGAGGAAAA
CGTCGTACAGCCGCGCGACATCTTGGAAACGCCTCAGTTGGTGCGCAAACCACGTAATCAGCCATGGTAAAGCGAAGAACGGTTCCACCTACACATTCGC
AGCAGTAATGCATGGTGAGAATAATCCGCCGAAAGCGCGTTTGCACCATCTCAGCCAACGACGCACCCCCGATTCATACAGATGCTGGAAAAGCACTTCG
TCCGCTGCATCTAGCAATGGAAACAGTAGCCTCGTGGTCGCCATCACTTGTTCGAACCCCGAGCGCATCGGCTCGCGTTGATACGCCTCGCTCACGTGCA
GGACAGCTTGCATCGTGCCCTTTGAGTTTCCCAATGTCAATAAGAACACGGACACGATATCGTGGTACCCTTGAAAGTAGAACAGCTCGTCATTGGTGTC
CAGCACGCCGAGGATGATCTGCGTCAGTGCGCGGCGCTTGACCCGCCGCTCGCTCTCTTTTAAACCCTGCAGCACGTCGTAGTGCCACAAAGACCGCTCC
ACGTCCTTCTCGATTTGAGCGGCATCGCGATGCGCTTCCAGCGACGAGTTTCCGGTGTGCGGGTGTTCAATTTGCGCTGCACTTGCAGTTGCATCATTGC
CAAGCAGAAATGGCCACAATTCCTTGCGGAACTCCCCCGAAACCAACCCTTTCGGTGTTATCGCGAGGCGGCGCACTTGGCGGAAGCACTCGTCCCGCTC
TCTGGCGGTCGCGTCGTCGCGATCAAGAGAGCGCAGGCGCAGGATAAGTGTGCGCAGTTCCGTCTCCTTGCGTTGGATGAGACGGCGTTCTCGCTCGGCG
GGTGCCCGGCCCGGGATGCCCCGCACACGACGCCGGTCGTGGGCGCTTCGCTTCTTGTTGCCCATGCTGTTGCGTTGGATACGGTGGCATTCACGCGGAG
GAGGTCAGTAAAGCGAATGCTGTGCTGTCGTCATTTTTAGCCAAATTGTGGTGTCGACATAAAACGAACGGCAGAAATTAAAACGGAAATTCTCGCTGGA
TGGGGGGGGTACATTGGATGTGATGGCGTCCGTCAAGCAGCCACACTGCGCCACATGTAACACTGCTGGTATTATAGCAGAGCTGCGGCAAGCATGTGTG
CTTTCCCGTCGGGGTCAGAGCCCTTCCTTTGTTTTTGCGTCTCGTCGAGATCGCTCAAGATGAAAATGGACCTTTTTGCTGTTTAAAATCCAGCTTCCTG
ATTTCACAACTTGCCCCCGGCGCAAATGCCCCCTATTTTTCACAGGATATTCATTTATGAAGGTTTATCACACTAGTAAATCGTTCCGTTTGCATGGTTT
TTGCCAGGCTATCATATCTCGGGAGTCTGATTTTTCCCGCCCAAGCATCGTCGCCTTTCACTTGGGTTCAGTATGCCGGTTACGCCCGCGGCGGCGGTGG
CGGTGGAGGCGGCGGCAACGGACGTGGCTCAGTGCGGGATCTCGCGAGCCGACAGCCAAGGGTCCGCAGGAAACACCGATTGGACGATCGCTCTCTTCCT
CGCCCCATACTGCGTGAGCACTTGCCAGTCGCGATCCGGCGATAAGACCCTCCACCAGCTGGGCAGTCGCACGTGCACTTAGCCAGGACCTCGAGTCTCG
TCGAATTGGCACTCGCTGTCTCTCTCTTCCTTCCCCAGGCCCCCCCTCAGTCAGTCTCGAACGCCCCGCAGCCCGCGCAACATGGCGCGTTCCGGCAGCG
ACGGCGACAGTGATGACGCCATGCAGTACAGCAAGCCGCTGCGCCAGCAGAAGAAGCTCTGCGATGAGGGCATGGAGCTCGTGAACGCCGGCGTGGCCAT
GCAGAACGCGTCGCCACCCGACGCGGCTGGAGCCGATGCCAAGCTCTCGCGTGCCGTGACGCTCATGGAGCAGGCGCTCGCTATCGAGTATCCCACGCAG
GAGGAGCGCGACGCCAGCCAGCGCCTCAACAACAAGATGAACCGCTACGTCAAGATGATCCGCAGCCAGCGCGAGAAGGGCGCAGCCGGCGGCGCAACGG
GCCGCGGACACAACACCAAGTACAACATCCTGCCCATGGACAGCCTACCGTCCACGTACAACGCAGTGCTCGACCAGCTCTCCAAGTGAGTGCCCTGCAC
TTTGTGTCATAGTTTTCTGAAAGGGGACACTAACTGGTGATGTTTTGTTTTATTCTTCTCTGACAGCTCGTCAACGGCTGGAGACATCTTTGAGAGCCTC
AAGACCACGTTCGGTTTCCAGGACGCCAATGTCGCCAACCAGAAGGAGCACGTGCTGCTCATGCTGACGAACTTTAAACTCCAGGAGGAGGAGCCGAACC
AGAACACCGAGGAACACCACCAGCTCGACCGACAGCAAGAGCAGGACATGGCCAACAAGGGCATCAAGCGCTTCCACGGACGCCTGTTTGCCAACTACAC
CAAGTGGTGCAAGTATGTGTCGACCAAGCCCGCGTTCACGAGCGACCCGCTCGTGGATATTGTGCTCTTCTTCCTGATTTGGGGAGAGGCTGGCAACTTC
CGGCAGATGCCCGAGTGCCTTTGCTTTCTGTTCCACACCTCTCTTCCTCAGGCCTCGTCTCGTGGTGGCAGCAAGCAGCCTGGCGACTTCCTAGCAGAGG
TTATTCGACCAATGTACACTGAGCTGAAGAAGGACAACGACAAGAAGACGTCACAGGGTGCCCGTGCCCCCCACGCGGAGATTCGTAACTACGACGACTT
CAACGAGTTTTTCTGGAGCAAGAAGTGCTTGAAGTACAACCCGACTAGTATTCACGAGGCTTTTGGCGAGGTGGACAAGAAGGGCCGCCCCAAAGTCATC
AAGAAAAGCTTTGTGGAGAAGCGCACGTGGATTCGTGCTCTGATGTCCTTCCGACGTATTTTCTGCTTCAACTGCGCGTTGTTCTTGGCTGTGTGTGGCT
TCTCGCTTAATGTGGTCATGTACTGTCCAGACACACCTATCCTGTACGGCGCAGGTCTGAGCAATGGAAATTCCCGAGGATTCACGGTCTTTGGCAAGAA
CATGACAGCATCTGATACGACTGCCATCGGATCAGGCGATGGCTCCGGCGACAAATCCAGCTCGGGCTCCGGCGCTAGCTGCAATCACCAAATGCTGGCT
ACTTGTCTGGGCGTAAACTACATAGAAGGCGTCTTTCAAGACATCCCAGTTGATTTCAAGGCCTTGCTCACTGTGGTGCCCTTCACCGACTGTCTGGAGA
AGACCACGGGTCGCTGCGGTTGCTACTTGGACCTCATTGACAACTGCTTTACTGAGACGGGCACCACTTCTCACGTTGATGAAAACGAGCTCACGTTTTC
ATCATCCAGTGACTATGACCAGAGTATGTGTGTGGTGAACTGGCGTGCGGCTGTTGAGTCCATTATCAAGAATCCTGGTCCGGGCAAGCTGAACTGCGAG
ATCTGTCAGCTGGACATCAAAGCTTTGATTACCAACGGTAAGATCGGCGAGCTAATTGGCGGTCTGATGAAGTTTGGCGACGGCACACCACTTGCGACTG
GAGACATTGATAACACCGACCGCACTGATATGGGCGCGCTTGCCATGGTCGGCGGTGGTGGATGCCTTGCGCTGGTCTTCGTGTGCGAGTTCTTCAACAA
AATCTTCTCGCGTGTTGGCTCAGGGTATGTTGGACGATCAATGCCGGTCCCATTTCGCGCATACTGCCGCTACGTGTGCTTCTGGATTTTCTTGTTTATG
TGCAAACTCACGTTTGACTACCAGTACATGATCAAGGCCCTAGTGGAGACGACATTGTTTATCTGGTATGCGAACGAGGACGACTACCTGCCGTACTCGA
ACTTTATTCTCCAGGTCACGTTCCACAACATTATCTACATCTTGTTCCTGTGGATCCCCGCGTTCTTCGTGTTCATGTACGACGCGCAGATCTTCTACTC
TGTTTTGTCGGTGGTCTTCGGTTCGTTCGCGGGTTTCAATCTGCGCATCGGCGAATTGCGCTCCTTCCGTGTGCTCCGTCTTTCTTTCAAGTCGATCCCG
CGGATGTTTAACAAAAAGATTGTTCCGAACATTCAAGATGGAACGGCTGAGGGCAAGAAGAAGAAAAAGAAAAAGAAAAAAGGAGAGAAGGAAGACACAG
TTATGCCCGTGCGCCACTTCGAGCGCGTTTCGATGGCCGATGGGATCAAGCCTCTTACAGTGAAGGCTCAAATGTACTCGAACCTCCTGGACCAGCACGG
AGATAATCTGTACAACGAGGTCAAAACTCCCAATGACAAGGACGACGCCAGCTCAAGCGGCCGTCAGTCGCAGCTGGGATCGGTTACGGGTGTCTCTGGA
GCAGACTTTGAGCGCACAATCCCTTTCGCAATGGCGTGGAATCGTTGTTTGGGTAGTCTGCGTGAAGCTGATGTTATTAGCGACCGTGAGCTGAACGTTC
TGAGTTACCTGATTGATTCTAAGGATGCTGAAGACCGTAAGCTATATCCTCCGGCCTTCTTGACAGCTGGCAAACTGGATGAATCTCTTGACATCATCGT
TGATTGCTCGGCTGTTTACGAGAAACTGAGCTCCGACAAAAAGAAGAAAGAGAAGACACTGCAGAAGATCGAAAACACGATGCGTGACCGTCTGACAAAG
GATGATTTGCGCGTGGAATCGCTTCTTGGGTCGTACAAGTTTACTTCTCAAGCCATTCGTTACTTGCTTGGTGACGAGCACAGGGATCTAAATGAATGCT
TCGAGTTCATGGAGGAAATGGCCGCACAGCAATCGGTGCTTAAGGGTCTCAATTTGAAGAGTCTTCACGAGTGCCGTGCAGCGTGCGCTGAGCTAATGAA
GGCATTGCTCGAGGTGCCAAAGACGACATCAGACAACAGTATCAAATTCCAGCGGGCGCTTTATCGCGTGATTGATTGCGTGGAAACTGTTCTCAACTGC
ATGAAGAAGATCCTCGTGAAGCAGGAGAACCTGGTGCAGATTCTAACGGATACCCCGCTGAAGCAAAGCTCGTTCTTCTTCCCAGGAGATGCCCAGCAAT
ACGCTAACATGCAGCTGACGCGCTTGGTGAACTCGGAGGCCGCCCTCGATATCGTGTCGCGCGCCTACCAACTACTGACAGTTGACAACTTCGATGCCGA
GCCTCGTTCAGATGAGGGACGTCGCCGCTTGCGTTTCTTCGCTAATTCGCTCTTCATGGATATGCCTGATGCCAAGCACATTCGCAAAATTCGTTCACTG
ACGGTGTCGACACCGTACTACAATGAAATTGTCTTGTACTCGATCAAGGATTTGACGGCACAGAACGATGACAGCATCAAGCTGTTGTACTA