Description :
From Genome Similarity Track
Location :
Scaffold_113:31682- 32853
Transcript NameFunction/comments
Albla_Nc14072820inositol3 putative

Sequence
1171 bases(100 bases per row)
GTACTGGTGAATTGAAAACATTTACTTGCATAAAATGTCTTCAGATCAGGAAGAGGGCGGACCGATACAATCATGGACTTGACACGAAGTTGAGCGGCTT
CAATTCTTTGATGCCGTGAGTCACAAACTTCTTTGCTGGGAAAAAGGCACAGGTTTTTGGACTTGAAGTCGATAAGGTCTGTTTGCAAGCATGAAAATTC
GTATAAAATATTCTTTTTAGAGGGCTGAGATACCACAATTGAGCTTTTCTGTGCCCAGTTACTATCATTGCAATTAGAGGAGGCTTCGTATGGTAAGGAG
TAGGATGGAGATGGAATTGATCCACCAATGCGTGTCTTCCTTTCATCCGAAGCTGTCAGTGAATAGCTGCTTCGATGTAAAGATGTTCTTCCTTCCTGAG
AGCAAGTATCTCCTTGATCAGAATCTGTCTCCCGGATAAGCTCATACACCAAAAAACGCAGTTCCACATTGCCTTCTTCAGTCAAAGGGAGTTGCAGAAC
GGAGGAGAATGAAGCCTGTAAACACGAAGATGAATCATCTTCAAGGGAAGGGACAACTGTCTCTGTGATTCCCACGCGTTTCCAGCTGTGTGCGTTGCTA
CAAGCCCGACCACGAAATTGGTGCGTTGCGAAATTACTGGTCCTCGAGAAGTGATCACCCTGAGGCCCGAAACCAAAACAAGAAGTGGGTGGTTTGATGC
CCCATTTTCCATGCTGCAGACTAGTTTGCACGAGCGTACTGATGCTGCTCGTCTGGGGGAGAAATCGGTTCGAAGTTGAGTCATTTTTTTCGACCTTCTC
GTTTTCCTCTGCTTTTTGCATCCCACCTGCGTATAATTCCACAAAGCAACGGGAAGGTTTTTTCCCTTTCCTATACATCAAATTTGGTAGCATGAGCTGC
AGAGCGATCGTCAGCACATTTTGTGAGCCTTCCATCGAGAGGATCGATTGTCGAACATTCTCATACTTGGTAGTTTCAGTTTCTTTAGTTTCTTCTTGAA
GGCCCCCAACAAATGATTTCGCAAATCCCGCTTCGCCAGAATTCAAGGATAACGAATTGCGCTTCAAATCCGTCGAATTTCGCCTACGATTGACCGAATT
CATTGCCTGAAAATGGCCATCATTCGATTCTTTCCAACTTAAATGCTGAAGCCGGGAATTCCACTGCAATA