Description :
From Genome Similarity Track
Location :
contig_3:316789- 319210
Transcript NameFunction/comments
g821.t1hypothetical protein F441_04705

Sequence
2421 bases(100 bases per row)
AACTCGAGAGACGGCAAAGCTTCGTCGTGAAGCTCAAAGCGATCACACTGCTGAGTCCGATCAGTCTGTAGCAAAAATTGATGATATAGCAGAGGAAGAA
AAAGACGAGAGCGCTGCCAGTCAGAACAAAATGTCCGGACTATCGACGCCATTCACGAAAACTGCTCGCCCAGGGGCTGGAATTCTGGTCTCACTCAGCG
GGTGGACAACAAAATTTCCGAGTCAAACTGAAAGTGATCAAACTGTTGAGTCTGACGAGTCTCTGAAGAAAATCGACGAGGCAATAGTGGAAGGAGAAGA
AGTGTTCACTGCATTTGGAGCGAAATGTCCGGACTAGCGACGACATTTAAGAAAAATGGTGCCACCTCCTTATTTGCTGACACTCTGGCACCATTCAGCG
TTTGGTACTTTCAGGATCCTGCTCTCGTTGAGCAGCTCGGCTGGCAGGCATTCGAGCATTATGTTCGGTTGTTGCGGTGCCAAGTATCCGACCTGATAAG
TGAAGGCGGAAGGTAAATTTAAGAGGAGCACATCGTTTTTGCTCACTCGAGTTGTTGGAGACTAATATTTCTGTATGTGTTGTCCGGTGTTTAGTTTGTG
CTAGCGAGAATCAAAGGGTTACTAACGTAGAACGTCAAACACCTCGACAGTCTATGGAAAACAACACAGGCAAACCCTTGTTCTTGGTCCAGTCCGTGTC
CTTGCGAAAGAAAAGCATGAAGGCTGAACTGGACGAACTCACGCAGCGACTGGAAATGTACCGTGACACCTACGACACCTACACTAAAAATCGAGAAGGT
AAATCATGACCAGACGCGACGACATTCAGAAGCTGTACGACGCGGCTGATGGGTCGGTAACGCGATCAAATTCCAAGCGGAATTGTGGAAACGCAGAACG
ACGATGTGAACAAGTTACTGAGAGAGGTGAAGACCGATGTCATGCGCCTTTACGGCTGTCATTGTGGTGAAGCAAGGAGCACCATGACATGTGGGCTGCG
CTCAGTGAGTCTCTTCCAGAGGCAAGTCTCACACTACATTCGATTGGCTGGATGAAATCTTGGTATTAACTTCATGCTGGATCTTGCTCAGATTATGCGT
GGTGGTAGGTGGTCTCCGACCAGAGTTCCATGATACACTTGTGCTTAAGTGCAGCTTGCATTACGAATGTCAGTCCAGCCAACAAATCCAAGCTGTTAAT
TTCACTACGCCATTTGGCGATCACCGGCACAAAATAACATCTGTCCAGCAACACTACCAAAATACTACTGGAGCCGTCACATTATCCAGATGGAAGCTAG
AATAGGATGCCATGCGGCTTCATTTTGGCGGCCGGCAACCAACAAAGGCCAGATGACCCACACGAAAGAATCAGAAGGCACGACACGGACGAAATGGGCG
CTCGATCGAAATCACTCGAACCACCACTTCATTGTCCAATTCGACTTGGTCCGCACACTCGAGCTTCCTTCAAACCGCAACAATGACCAAGCTTCTCACC
ACCGTCGCCACCGCTACAATTGCAGCAATCGCAGTTACAAGAGCCACCGCCGAAGACAGCTGCGTGTTGGTGGACTTCACCGCCGAAAAGTCCGAATTCG
CTTCTCTCAATGCTGCGATCGACCTCGTCAAGGCTGCCCACGTGGTTGATTCGATGTTCGGGGAGTATGACCCCTTAGTTCTGCATGACATTACGCTCGG
CGAGTTCAGCCACAGTCTTTTGGGGCAGAACCTGACGATCGTACCCACCATCGACTCGATGAACGTCACAGGCCTCACCACCTTCGCGTTTGATCACGTC
AACGTCACGTCCTCGAATTGCGTCGACGTTGGGGTGTACTCGGATGCTGAAGTGTCGGTCGACGCTACGTTGAGCATTTCGCTCAAGGAGCTGGATGCGA
CTGCCACCGCACACGTAGCCTTGGCTTTAAAGAAGCCAAGTTTTACGGCCAATATCGAGGCGAACATTTACGCCTGCGCACCAGGCGTATCCACGACTTC
ATGCTCGAACATGACTGTTGTGGGGATTCAAACCGAGGTGGTCAGTGTTTCCCACGGTGGCAGCTACAGCAACATCCTAAAAGAGGTGCTCATGAAGTTC
AAAGACGCGTCGGTACAGTCGTTCGCTCTGGACTTCTCATCGGTGTCTACGTTCGACATCAGCTTCGATAGCTCCAGCTCAGTGTTCTCGTCGATCACGA
GTCTGCTCACTGACTACTCAGCAATGAGATCAACAAGAAGGGCGACATCTACGACACTCTCATTTCCACTTGCAACGACGAAGTGCGACTGCTACTTAAT
GATCTCATTGAGTCGAAGCTGAAGCCCAATTTGGGGCTACTTGCTTATCTGAAAACTAGCTGGTGAGTGTCGGCTACGTCACGTAGTGTTTACATGTACA
AGCGTAGATTTTCTGAGCGAG