Description :
From Genome Similarity Track
Location :
Scaffold_431:31664- 33052
Transcript NameFunction/comments
Phyta_totarag8234hypothetical protein

Sequence
1388 bases(100 bases per row)
CGAAGGTCAGACACTTCTCTTCACCCGAGGCTTGGTCGCGCTGGAACGCCGACTTAACCTTGCTGAACCaagctcgcgctcgctcttcatcgtgatCCTT
GCCCGTGAACTCCTTCAAGCCGGAGATTGCTGAGATCCGGACTCGCTGGATCATGGAGGATCCGACCGAGCCAGCTGTCGCTGTTGCCACGACCGCACGT
CAGGCGTCCAAGACTTTGAGGTCGTCAGGATCGTACTCCAAGTGCTGAAGGTCGGGGGTCCCGACCGATTCCATCTCGACGTCCTGAGAGCCGGGCGATC
TCGCCCGAGTGACGACTCGTGGGGTGGCTGATGCCTGTTGCTCACGCAGGGACCGGCTCCAGGCAGACTGGAAGTACGTCTCCAGTCTGTCTGTCGGCTC
GTGCTTTGGATCCGTGACTGCGGGtcgagcgactgcaagtcGTGGATTCTCTGGATCTGTGATCGGGAGAGCTGTGCGGGAACGCAGCATCGCCTCGCCC
GAAGGGTCAAGCGACATGCGCTACAGACTGTTGGAGCTGTCCGAGTCCACCTTTGACGTCGCCGAGGCGTAGTGGGAGGATCCTGTCTGGTAGTCCGGGG
TGCGGATCTGGGGAGACGGCTGACGATCCTCAGTGCGAGATGTCTCGCCCACAAGGAGCTTCAGCTTCCCGAAGAGACCCACAACGGCAGTCTTCATCAC
GTCCAAGTCCAGGTTGAAAAGGTCGTTCGCGTCGAACGCCCCAGCAACGATGCCAGCTTCCTTCAGCAAGATCTTCATTGCGGTCAGCTTATTCGTCGTC
GCCGGTGGAGCAGTTACGGGCCCCAAGCAACTGTAACTGCAAGATCTTCATCACAGGCCTTCGGTCCATGTAAGCTTCAATTCATCAAGACCTTCACCGT
CCGACTCTGGAGCCTTGAGTTTCTTCCGTGCAGCCTTGCTcttcgtgttcttcttccttgatGCAGTCTTGGAAGCCGGCGGAGTGATGGTGGATGAAGC
TCCCTCAGTTTTCACTGGCGGATCATCATCCGGCCGGTCTCGATTCGCATCAAGATCCGCGGGGGTCCCCGGAGGGACCTGGGGAGGAGGTTGAGGTTTT
CTTCGAGAACCGGGTCCGGATCCCCCTCTCATCCGTCGACAGAACTCCTCCCAGGGATCTGTCGATCCGTGGATCTAACTttcagcgacgtcgtcggcga
TCCAAATTCCGTCGACGCCTCATCTCCCGATTCCTTGCTCGCAAGCACATCTTCTTGGGACTCACGGTGAAATCCCGCGTCGCCAAGAGatccgggcacg
cgcaccattGTGGTGGAGCGGGATCAGAAAAATCTGTCCTCACACGCACACTTGTGCCCAGACgccgactaacggagggggtactccg