Description :
From Genome Similarity Track
Location :
Scaffold_47:31658- 36194
Transcript NameFunction/comments
Phyke_g2389hypothetical protein PHYSODRAFT_354938
Phyke_g2390hypothetical protein PHYSODRAFT_511599
Phyke_g2391conserved hypothetical protein
Phyke_g2392hypothetical protein PHYSODRAFT_561910

Sequence
4536 bases(100 bases per row)
CAAGCTACCCGCCAAGGGCTGGAACGTGGAGGTGACGGAGATCCACcacaccaagaagctggacgcGCCGAGCGGCACGGCCAAGACGTTGGTCAAGTCT
CTGGCTGCCACCGGTGCTCCGTGCCTGGGCGAGACTGGCCAGGCCCCGACCCACTCCCTGCGTCTCGGCGACGAGGTTGGCCAGCACACCGTGCTGTTCG
CTGGCCCGGGTGAGCGTATTGAGATCGTGCACCAGGCTACGCGACGAGAGGTGTTTGCCATCGGCGCTGTGCGTGTCGCCACGCTGGCCCCGACGCTTCC
TCTTGGCCTGCACTCGGACTAAATCGATCGCGCGGAATGGGAGTCTACGCGCTCGTGTAATGTAGGCTAGTGCTCCTCTACTTTCTCGCTCTATGACGCA
TTGCATTGCCATTGCGCTGGCGAAAAATAATTCGTGCCTTTAGATGAATAAAATCGTGAGCCACTGTAGCATGTTCATTACTACCATTGTTCACATGGCT
GAGCTCATTGATAGCTCCCATTGCGATATCCCAGCTGTTTGAGCCGAACAAGTGCTGACTATCAGAGAGTATATCGCCTCTCCATTCCGCTCTTCattct
tcatcatcgacgCTGAAGCACACAACCTCTCCACCATGAGTATGATGGGGTTGCGTCCAGTGAGCGACCACCCGGTGCTTGGCAACGGTGGCGGTATGTT
TGACGTCCCCAATATCTCCATGTCGCTCACTGATGCTCCTCCTGACCCTGAAATGGAGCTGAGACCTTCATCCGTTGCGATGCTACGAGGCGAAGGCATg
attgctgaagaagacccaAGCAAACCTTCCTGgatggaagaagaagctgctaAAAGTTTGACCTGCGCTCAACAGTTTCGTATCGTGTTCGACTCGTTGC
TGTTATTGGTAGCAGCTGGAGGCATCGCGTTTGCTTCGTACTGGCCTGTGGACATAGAAAATGGCATGCGATATGGCGGAGTTCTGCCCTACATTTACGC
GGTTTTCGTGGCCATTGCAGGCTATGAGTTCGCATGGCTGAGTTATCGTGTTCAGTTGAGATTATACCTGCCTTTCAAGCTGCATGAGAAGCAGACGTCG
CGAGAGATGTACCGACAGATCATTTCGTACgcagttgatggagagaCTTGTGCTGTCACGCCTACAGCCGAGAGATTTTTCTGTGGGAACACAATGGTGG
TGGCGCTATTGGTGGCAGTGCtagctgcaggagctggtgtGGGGTTGTGCTTCATCCCCGGGTTCTCGCAGATGCCAATGATCTACGTGGGAGTGAGTGC
TTTCGTTGGCACGTTCTCGGCAGCGTTGGCACCGAACACGACTACCGCTGTTTGTGTGCTGATCCGGTACGCCTACTTCTTCCTATCGTCGCTGAATTTT
GTGCTACGGAGTGATTTAAAAGACATGAGCACTGGGAGTGGTGATGACGGCGGCGCGATTGTCAGTCGACAGACCATGGACAAGTACCTCGCCGTCGTGG
TGGAATCTTACTCTCTGCTCTTACTAGgtgtggcgctgctgctactcaCGCGCGCCGTGACGAGCAAAGATGCAGTGGAATCCGCCGTCATGATCGTACT
GGATGTCGCTGGCTTGCTCTACATCAGCTCTACCGCGGCTGTGCTGGAACTCTTCGCACAGTCACCTCGAGTACGTGGTAGTGGGGCGTTAGCGGGGTTC
TTTATGATCGTGTGGAGCGCCGAGCTAGGCGCATTCCTCACCGAGCGGATAATGAAGTCTGTGGACTTCCCGTGGATGCATCCGTTGTCAAAGTATGTGT
CTTCGCAGCAGAAtttcgagaagctgctcggAGCAATGGTGTTCGCTATCGGTGCTACCTTTGTCGCTGCTAATTTTGTGGAGTTTGACATGGGTACGCA
TTACGTAGCGCTGTTGAGCGCTTGTGCTGTGGTGTGTGCTCACTTCGGTAAACTCTTCCTTGTGAGCCTCAAGAAAATTGCCAAGGTTTCCAGAACAGGC
TCGTACCTTCgcgttggcggtggtgtcCTCGACCGCATGGACACACTGCTCTTCATGACGGTCGTATTCGCGCCATTCTTTCAGCGCGCCATCTACCAGC
AACCACAATGGTAAACCAACTTGTCAGGACGAATGCAAGAAAGGTGCCAACAGATTCAAAGAATATTTAACGCATTGCCTTCCTCATCGCTTCCTGGTGC
AGCACAGCACTTTACTCTGGTTACATGACAGTGCAACCcttctctccatcttgaagATCTGcaccgtcttcttcttcttcatcatcactctTATCCTCAC
CGTCTTTTACCTTGGGTTCGCCCGAGTCGTCACCAGCAGTCTCCGTACCGCtagctccttcttgttgcttctgcATCACCTGGCGCAATCGCTCCACATC
ATGCATGGTAAGCACTGTGCTGTTTCGGATCACAAGCTGATCATCGAATCCGAGAGTCTTGCAGCTCAGCTCCAGTTTATGCTGTTCGTCTTCCAGCCCT
AGTAGCTCTCCCATCGTATTTTGCATGAATAGTGGCTGGTTTCCTACAAGTTCAATCTGGGCGTTCAGAGATCGCGTTAACCATGCCAACTCGCTCACAT
CAGGCACGCTGGGGTCTCCCTTGCGAAAAACCACGGGGGAAGGGTACAGGTCTTCGCCTTTGACTCTCGCAATCGGAAGCGAATGTTTGGCAACGACGTC
CAAATCATCGAACGGCACAGAGGTCTGCGGGCCGTACATGATAGACATTTCCTTGGCGCCCCACATAATCTTGTTATCACCAGCTCCGCTAGTAATGGTG
CTTCCAGCCGACGCGCAACTGACCTTATGGTCTTTCCAGTGCCCGCGTTGGCATTGTGCATCGCAGTAGAAGGTGCATTTGCAACGAGTACAGCGTTTGA
GTTCCTTACCCGAGGCAGCACGCTTATCACATTTGGCACAGCGTCGCAGCTCGGGGTTCTCCATGAGCGCCAACTGTTCGCCAGGAGGCAGCACACGTCG
CTCTAAGTCGGCACGAGTGTAAAACAGCGCCATGCCACGAATGTGGTCACTTCCCTCGCCGTTTGGACCACTGCCGGTGTGCGTGCTGATGACGGACGAA
AAGACAGTGCCTCGACCAACCTGGTGGCGAGCATCCAgtcgcagctcttcctcccCAATGGCATCGACCTGGATAGCCTGCCGCTCCGCTAGGTGGTTCC
ACGGCTCCAGCTTCGCGTACTGCTCGCAGGCTGCGAAGAAAGCAGAAAGTGCCTCGGGTGTCACTCCCGAGCCCGAAATCACTCCAGGCCGCTCGCTCAC
CTCCGCCACAGACGCCAAGTCGTTTCGAATCAAGTGCTGCGAGAGTTCCCTGCGCACATCACGACTCGTTAGTAAATAATTCTACTTCAGTTTTCACACT
AAACCAAAAGCTGAGCGTACTGGATGTAGGCATCGATGCCGTCCGACTCTGACAGGTACGAACACTCAATCCCCAGGGCCGAATAACTCTTGCGCAGCTG
GCCGACAAAATTTTTGTCCGGGAAAACGATCTTGTCAGGTCGGTGCTGGGGTGTGTTAGTGGGCGGGTCCAGCATCGCTTGTAGCGTCAGATCCAGCACA
GTTTGCGGTGATGGATACACCTCCGGCGGGTCACAGATCTTCTTGGACACCACTTGGCCTAAAGGATACAAGTTATTCACCAGGATGCAGTAAGGTCTGC
AAGGAATCGCATCCTGTCCGTCTTCAGCCCCAGAACTGGACGCTGACCACACGCGGAGCTGCCGTACCACCACTTGCCAgacctccagctgcttcttctc
caacttcCGGTATCTCTCCACCTGCTTGGGCTTTAGCAACATCTCCGTACTGATCACAATGTCCGCTGTGAATAGTAAGAGATACTTCAGTACAGTAGAG
GAAGTAACAGTGACATTAAAACTATCTTACCATCGCCTTCCACGTCGAATTGAGTGGGGACTCGTGGTACATCTTCACCCTCAGAGTCAGAGTCGTCCTA
TATGGCATAAGATCAGTAGTAATTAGCAACATAATGGAGAGAAACAGCAGCGTTCGAGTACGAGAGGAGAAAGGTTTAGAAACCCCCATGTATTAAACGC
TAGACAGCGAGAAAATCATGGATTGAACCACTGAGAGATAGCGACGACTGTGGGGAAGAGTATACTCACCGCAAAGTTGTTCCACTTCTCGTATCTCTTG
GTCAGGAACTCCTCAGACGTCGCCATTCCGTCGATCGCGCTAGCAGTTCTATTCCCTTTTATTGAAATTTCCTTATCAAAGGAGCGTAACCTTATCGAAA
CATATTCGTAACCCTTACGTAACCTTTATGTAACCTAGATCACTTTTTTTCTTAAGCCATCATGGAGAACCTCGTGGAGACTCTGCAGACCCAACGCGAT
GAACTGCTGGCGACGCATGCGGCGACTAACAACAACCAAGAAACAGAGATCATTGTGCTCCGACTGAAGGCGCTCTCGGAGGAGTTGGAACTTGTGGCGG
CAGCTGCGACTTCCGCTCCCGACCCAGCTGCACTCA