Description :
From Genome Similarity Track
Location :
Scaffold_8:316544- 324656
Transcript NameFunction/comments
Phyin_T30-4PITG_06215Putative uncharacterized protein
Phyin_T30-4PITG_06216Serine-pyruvate aminotransferase%2C putative
Phyin_T30-4PITG_06217Putative uncharacterized protein

Sequence
8112 bases(100 bases per row)
TACCTCTCGCACCCTCGCACACCTCGCTCGAGAAGCCGTCAAACGTCGGTCTTCTCCAGAAGCATGAGATAACTCAAGACCACACAAGTCGAGGCTTAAG
TACAACACGCACCTTGCTCAGCAGTCGACTCTAGCGCTTGCTCCTCATCCCTAAGGTGGCGTCCTTCGTCGTATGTCATAGCGTCGGCTCAAAGATCGAA
TAACCCTTCAGCTGTAACCAAATTAAAAGGGCAAAATGATGCAAATTAAAAGGGTTACGCGCTTCCGAAACTAAAATGTGCTTCTCCATAGTTAAGGAAT
CTCTCACGCAGACTTTAATTAGTCTTGCGGCCATTCACGTCGGCAATGAACTTGGCGTACAGGAGACTGTCACGACCAGTGTTCATGTTGGCCATGGCCA
TGATGGCCATGAGCAGCACAACTCCAAGCAGCACCGACGTCCACAAGATGATCTGGAACTCAGCGATGTCAGGCATCGACACAGCGCCAGGCGCAGTAGC
GCTAGAGGCGGCCGTCGAATTGTCTTCGTCCTCCCACATACTGCCACTGGCTGCAGCCAGATCTTTTTCTTCCTCGTCTTCTTCGTCTTCACCTTCACTC
TCTTCTTCTTCATCGTCTTCTTCATTCGATAGCTTCGTCACCAGCTTTCGGTTACGACGGGACAGAGCTGCAGTCTCGTCGATGATAGCAGGCAGTGTGC
CTGTCATTATCTGAGCGGCGACGGTCTGCTCAGTCTTCATGAGTTGAGCCAAGAACTCGGTCACTGTGGTCGTCACAGCCTGTTGCGCCGCTCTCTGTTT
GTCTCCCTTCAGAGTCGAGAGACCTACTAGGAACAGCTTCTTGCCCTGTGTATACTTTAAATCCGATGTGAGCTGCATCACCTGAGCCAACTGCTGGGCG
AAAGCCACGTCCTGCTCGTGAGTGGCACTTAAGAAGCTGTTGGCCTTGAGCACCTGTAGCACCACTTCCGCATCCACATGGGGCTTGTCAGCGCTCACAC
TGGCACATAGCGCGGTACTACCGGCACAGCGAGTGGCTGATGGGTATTTGGCACTAAATTCCTGAGCTACAGCCACCGGAACCTTAGCGTTAGCAGGTTG
CGCCGGGTAAAGCTTGTGGAAGGCTTGAGCGCCGCTTAAGGCTGCGTTCACGGAATCTACAGTAGTCGCAGACGCGTCCTCCAATAGAATCATCGCGTAC
GCATCGCTGTGAGTGAAGATGTCGGCCTGTAGCGGGTTCTGGACCGCAGAACGAGAGGAAACTCGCCCCGTACTGAGTCCGAGTGAGTTGAGCGCCAAAT
CAGCCATACCCGCGGCGGAGAAGGCCCCAGAAGAGCGCGTTTCGTGCCATAATGGAGACGAGGACTTGCCCAAGATCAATATCTGGTCCGTGGATGCGTC
GGAGACCGCAAGGGCCGCCACCGAGAGCAGCAAGAGCGAGCGCATAACGCGACGATTGAGATGGATCTATCTGAAGAATAGAATGAGGGCAAAAAACTGC
CTGCACCTTCGCCGGAGTTTGGGATTTGCTGAAATTAGAGAAAATTGGATGAATTTGGTACAATCAAATGGGGAAGCATTTTTTGGACCATTCTGACAAT
CTGATTCCTTTCTGATTTAGCCCAATCAAAGTTAGCATCCCTCAGTCCACGTACTTGACGCGATGACACACCCGACCGACATGTTAGAGCTCGTTCCGGG
GCCGTCCCAGATGCTACCCAATGTTCTAGAAGCTTTGGGAGCAGCCTGCGGCTCCTCCGACCTGGATCCTGTTTTCTGGGATGACTATCTCGCTTTGGAG
CGCAATCTACAGGAACTTCTACACGCTGAGAGCTATAGTGTGGCCATCCAATCGGGTGAGGCCATGCTGGCGTTGTGGGGCGCCCTGAAGAGCACATTAA
AGCCTGGAGATGTGGTAGTATGTGCTGCCAATGGACTGTTTGGAGAGGGCTTCGCAGACATGGCCAAGGCTCTTGGAGCAGATGTTCGTGTGGTCAAGTG
CGACTGGCGCAAGACCATCGACGTGCAGGCTCTGAACGAAGAAATCCGTCGATCAAACCCCAAATTGGTCACTGCGGTACATTGCGAGACGCCCAGTGGT
GTGCTCAATAACTTGGAAGGCGTAGGGGAGACGGTGGCCAATGAGACGACCGACGGTCTGTTCTTAGTGGACTTTGTGTCGAGCGCAGGTGGTGCACCAT
TAAATGTCGACGCCTGGAAGATTGACTTGGGTTTATTAGGACCTCACAAGGCGCTCTCCGGCCCTCCTGCATTAGCGTTTACTACCGTGAGTGAGAAGGC
TTGGCAGCGCATCAATGAGGTCAAATACGTCGGATATGACGCTCTCCAGCCGTTCTACCGAGCAGCTCTTCAGGAACCCAGACTGCTGCCATACACGCAC
AACTGGCAGGCAATTCGTGCAGCTCTGGTTGCATGCAACAACATCAAACAGGAGGGTGGTATTCTAGCCGCAATTCGTCGCCACGCTGAAGTGAGCGCGT
ATGCACGTCGTGAGGTGAAGGAGACGCTACGTCTCAAGCTGTATGGGGAAGAGAGCGCAGTGTCACCGACTGTGACCGCGATTGTACTTCCTGAAGGCTG
CGACTGGGATATTCTACAGAACAAACTACGTGCGCAGAAGCTGCTTGTGGGTGGATCCTACGGGCCGTTAAAGGGCAAGGTGCTGCGTTTGGGCCACATG
GGCTCCCAGGCGAACAAGAAAGTCGTGGCTAAAGCGATCAAAATCATTGGCGCTGCGCTTAAGGAGATGAAGTAGATAGAAAAAAATAGCTACCGTGATA
GTTTAGTTCTTCTCCATGGCGAGAAGCAACGGGTTGTCGTGCTGCTCTGGCTTAAAGTCGTAGTGTATTAAGCACACCTGCGAGTAATGCACACAAACGT
TGAGTATCAATAAGGCAACTATTCTTTAGTTAGACCATGGCAAACCTACCACTTCGGGGTCTCCTTCGGGTGCACCTTCAACCCCATACTCTGCCAAAGT
CATCATGTCGTGTCGTAACTCATTGGCCTCGGCGAAGTGTCCTTTGCAGATCTTGAGCTCCGTGATCGGGCCGTGTTGCTTTTGAATTTGTTGCTGGAGC
CGCACAAGTAACGAGATGTTACTGAAAAGGCATCATGATGTAAGCAGTCGCAGTGTTTTATCTTTCACTTACTTTGACGGCAAACAACCGAGTGGAGATC
TTTGTGCGGAACTTGAAGTTGAGATAGCTCCAGTTGAGTAGCTAGCATTAAGAAAAAGTCAGTGTCCTCGAACAATAACCACACTTGGACTGTGCATTGA
GATTACCCGCATATCGAGTGTCACGTAGTGTACTGGGTCGGCTTGGATGAAAATGGGTGGAGCGCTGTCGATTATCTATTCGATAATACAAAGGCTTAAG
TTGGCATATCTGGTAAGTAGTTCTAGGCGTACAGAGGTAGCTTCGACGGCATTGTCGGCCGCATCTGCTCCACCAGCGCTGGCCTTGTTCTTCTTGCCCT
TAGTCTTCTTCTTTGGCGGCATAACTGTTTGGAGGCTTTTCACTCAAAATACTTTTCGCTCCTAAAAAAACGAAGATTCCTTCGATAGTAATCATTCCGT
GGTCACAATCGCAGCAGGTCCCGTTTTGTCTCAAATTGTGTAATGGTAACCAAATATCTTTTGGTATTTTTGATAGTAATAGTACTATTTTGATATTAAA
TAGTAAAAGTAGCAAAAGCTACTATAATATTTCAATATTTACTCTAAGATTTTAAAACATGTAGAAACAAGATAATATTTTAAAGTATTTACCCCGCTTA
AGTACGTTTCTTGACACCTAACCCTCTGTGAACCGAGGACTTGCAAAAGCTTGTTCAGTCAGGTTCTATTAATAGAAAAGCAGGAGGCTTTAAGACTGAA
GAGTTCTAGTATTGCACTGGACACCGCCCAAAACTGTCATATAGATGGCATTCGACAGGTGTCGTATGACCGTCGTAAGACGGAAAATAACTCCTGTTGT
AAGCCGTTGTCCAAGATGGAGATGAAAACTGCCCCCCAAAACTGGCATAAGCATCGTTGTTGCGTCCGGAAGAAATTGCCTCATACCACGTGTAAACACT
CGGTATCAATGATTTGGGGCATTATGAGCTGAGTGCAGCATAGTCAGGAAAAAGGGAAATAACATCGCATTTTTGCTTTCTTCGGATCCGTGCCGGATGA
GATCCTCCGAAATTGTTGCCGTCGTTGCAGTTCTCTGTGAACAATCTCGGGAGCTCCAGGAGCTGCGCCACCAAGTGAACGATCTACTGATTAGTGCGGA
GCTGAAGCGCGAGCTCAAGGTCCGGCATCGTCTCACAGCTTCCTGTCTCGGCGTGCCACACCTCTCTGCGTGGACCCTGCTGTACACGTACGGCACGGAT
GAGAACCTGCTCAGCGTCACCACGTTGACTCGGTCAGTTGTGCGATAACGGAAACCAACCTGGAATCATAACAAGTCTAACAAAGCGGGTGTTGATGTGG
TGATGCAGGGAAGCCTTCAACGAGCTCCTCGCTCGCTTCGCTGGGTGCTATACCATCCACAAACCTGGTCGAGTAGGCGGGAGGCCACCAAATTGACGAA
ACATCATCAAGTACTGGGGCTGTTGCTGCACTACTTCGAGGGTTCGATGGGTATTAAATCGCTTTGCGAAATATTTGCAGTCCACCCCTACGACTCTCCA
GCGAACATTGGCGCGTGCTCTTGAAGCATGGCTTCTACCCCGCACGTATTGGCTGGACTTCGCTCGAGCATCAACGCAGGATGGCAGTGTGGGTTGCGGC
TCACGAACCGTTGCTGGGCAATATCTTCGGATACGTGGATGGCAAGAATTATAAAATGAGTGGTATGCAGTCCATTACTGGCATGTACGTAATAGCTAAC
GTGGATTTTACTGAAGGTAATGCAGCCGAGTGATTCCGATATTCAGAATGCCTATTATAACGGATGCCTTCATGCCGTATTCGTGACTGGTACAATTTGC
TTTGGAGCAGACGGTTGTCTACTTTGGGCAAAACATAATTGCCCCGGATCGTGGAACGATGCGGATACGAGCCTCGAGCTGCGGGAGAAGCTGCTGGACA
CGACATTGTTCTCGGATCAAAGTCTCAGAATCGTCAGCGACTTCGCTTTTCCATGCTCGACTAACATGCGTGGTAGGATTCTCACACCGCTGAAAGATGG
TGACATTGACCGCCTCCTTTTTTCAGTACGAAGTCCAGCGCGACGTCTGCATAATGAGATAACGTCGGCTCGTCAGGCTGCTGAATAAGGCCTGGGGAGT
GTGGAGAAAGGGTAACATCGACTGTTGCTTCCACTTCCCTACGACCAAGGCCGACGTAGGATTCAGCTCTCTAACATCTTTCAGCTCGCAAACTACAGGG
TTCGTACAACAGGTATAAGCCAAATTCGTACGACCTGTACTCGTGGATTCGCCCGTGGCTGGATGGGTATATGGAGGGTCTGAAAGTTTAAGCTGTACTT
GTACTTGTAGTAGGTCTAACCCAAGCAATCGAACGCGTTAGATTGTTATTTACACCAAACGTGTCCTTCTGAAATTTGTCTTGGATGATATCTCACGGCA
GTCGTGGATTTATCCAGCAGCGTACAATCAAAAATGCGGTAATCGCGTAGCAGAATTCCAGTTTCATTTCAAAAGCTACGAGCATGAATGGAGACGTCAA
TTTAAGGAAGGAGGTCGAATGTGCAACGAAGCGGTAGTGTGAGTAGGAGCGGCTGACACCTTCCCCGTGGTGCGGCGTGTGGCGAACTAGATATCCACTG
AGGGGTGTTTTGCATTCTGAATAGCAGATAACATCATCATCATCTCGCGCATGTGTGCACGAGATTCCTCGCGGTCGATGCGGCGTCTCTCTTCGGCTGC
TTCTCTTTCTTCGCACCTCTCTTCACAGCGCCTTTCTTCCGCTGCTTCTCTCTGTTCTCGGCGTTCCTCGCGTCGTCGCACCTCGAGGGCTTCACGTTCG
GCGGCGCGCTTATTTTCTGCTGCTTCCACGCGTGCCCTGCCCTCCCTGTCAGCGTCAGCACGTAAGATCATGATAGTCTTGACTAACTCTGAGAAAGAGT
CGGCGGAGCTCTGCGTTGCACGGGTCAGTTTCTTTTTAAGATCGGCAGCTGCCTTTTCAGCCTTGATCCGTTTTTGCTTTGTGTAGCTTGCTTCTTCGAA
CTTGTCGTACGTCCGGTTCTTGGATGCATCCCGCATAGCGACCAAGCTCACACCTTCCAAGCGGTCCGAGCTCTCCGCTAGACCCGGATACCTAAGCTTC
TCGCGTGCTTCGACAGAAATAGTTGCTGCAGGCATCTTTGACGAACATGTGGTGGTTGCAGGCTTCTCTTGCTTGGATGTGCGTTTCGCCGGCGCCGGTT
TGGACGTTTTGCGGGGGCTGCGCCTCAGCACCAACTCTCCTTTACCAATAACGTTCGCATTTGCATCGATTGGGCTGGTGGCCGCCACTACTTTGGCGGC
CTCGGCCAGCTCCAACTCCAACCCGGACAAGTCTGTGCCGCCCCCAATTGCTACGCCATCGACACTCTCACGAAGGCTGGACCCAATTATGTCCGTATCA
GTATACGCAGAAGTTTCCAGCGCAGAATTCCTCCTCGTCAACGTCGGAATCGACCTCTTGAGCAGGTCGACCGCCACTAGAGTCGCGAAAGTCGATGACA
TCCGTCACGGTATTGTCGTCGGCGTCGCTAGTTAGGAAGACGGAGCAAGCATCGTCGATGAGTTTTTTTCACTTTCTTAGCAAGCCGGATATGCCTTGGA
ATGCTGGGATTGCCCGTGGGCTTTCTTATTCCCTACAAGGCCTTGAACTTACGGCGCAGGCTGTCGATATCCCGCTCAGGCCAATTGCCATCTCGTGTCG
CGTTATACCGCGCGGGTACAGCATCCCAGTGGTATTTCCGTTGCGGAAGAATGCGTTTGACGATATCCAGCATGTGGTGCATTTCGTGCAGTGAGTAGTT
GGCGGACCCGGTAGGCTTCCCCATATCGAACTGATTGTACACACAAGGCATCAAAACAGTCTTTAACTCACAGCCACGCTCAAATTGCATCCAGTAATGA
GCTTACACGTACCGAGGAGTGTTGTTGGCAGTGAGAATATGTGGGCGCCACAGATGAAAATCGGAAATGAGCTGTGGCGCAGCAACTGATCAGACGGTGT
CTCCTTGACCGCCAAAAGTCCTTCATCCAGATGATGCAGGACGTCACAGCAAAACCACTCTCATTGAAAAAAAAGTAGACAATGGTGGATCACGATACCG
CCACAGAGGTACTCAGCTACAGACCCAGGAAAACAGAATTGAAGACTTGGAGGTCCAAGGTCCAGATGGGAAGCAAAGCTACAGTGTGGCTACCGTACAA
GGAGGAGAGCTAGCAAGTACAGCTACGGGTCCTCTTCGTGCTGGATGGATGTGTGGATGCACTTGGTGTACTTACAACGGCACTCAAAGCAGAGGTCCGA
GCCGTAGTTCACAGTAACCTCGCATCCAGACGCTATGGGCCCGGTGGTGACGACAACAACAGTGTGGCGAGCTCCGTTTGCGAATTCAAAACCTTCAGCG
CTTGCATCGCACGCATGGTTAGCGAAGCGCATGCGACCACCCAGAAGATACGCATCGATGCCAACATTCCTCGAGCGCGTACCATCCGTTCGTGTACGAA
GGGTCAGCATGTAGCCGTCGCTCCTCTGACGCTTAGCCCGGTCAGTCTCCACATAGTGAAGCCGACCAAGGTACTCTCCGAGCACCTCACCACGTTCATG
GGCGACATTGGCAACCAGTGCGTACTTTCCCGTAGTAGGCTCCTGCTTTACATCGACATTGTTGGACTCACGGGGGCGGTTCGCGCAAAGCTCCTCCCAA
ACGCAGCACTTGTCGGTGCAAAACACATTTATGTTCGCGTTACGGCACGTGTCAATCCGGCATGGATCCTAGCAGCCGCAGTCTCCGTAATGGAACACGA
ACGGTAGTCGAATCGACGCCGGGTTGTAGTAGTCGTGCAGGTAAACTACCCGAGGAGGCCAGGGAGACGCCACAAAAGCTACTTCAGATGGAGAAGCGTA
GTCGATGTCTGG