Description :
From Genome Similarity Track
Location :
Scaffold_1559:3165- 4991
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1559-fgenesh-gene-0.2Zinc finger protein

Sequence
1826 bases(100 bases per row)
TCTGTCTTTGTGGTGTGCGTATAATACGATTGCATGTGACTGCGCGGTGGCCTTGATGGATGTGCCGCCCCGGCTTCGTGGCCGCGCTCGGCGCTGAAAA
GCGTCGCGCGCGGTCCCCCGTGCCGGGGCGCGCACTCGCCCCACTTACGCGCTAGAGCAGCCTTTGCCAGCGACTTTTGTGTGTAGAGAGTGACGACGCG
TCCGTTTGACACATCTCAAGAACTGGGTCGCACATGCCTTCTTGCTATCTATCTAATGCGTTGCGACAGTGTAGCGTTTGTTTTCGTGTTGAATACGTGG
TGTAATGGATCGCTACTTCTTTCTCTGTCTATGAGCGTCTCTTCTATATGATATTATTCTTGGTGCCTCTGTCTCTATCTGTGTGTCTATATGGCAGCTG
TCGGTCGCTGCGAAGAGCTTACTGCGTGAGGTTCACTAGGATCTCTGACTCGGCGCTCGCGATGCGCGAGTCCGACTCCTTGAACTGCCGCATTAGCTTG
GTGTTGTACGACATGCAGTCGTCAAACTGGCACTGCAAGCAACAGACAACAAGACCCAATTCAGCCCAGATATCCTCAACGAGACCCCAGCCAACACGAG
CAGATAACTACACGGACGGTACCAACCTTGTGGTAGACAAAGTGGAAGCTGGTCGTGGACTTGCGCTCGCAGTCGCTGCAGTACACGAGCGCGCGCACGT
CCTGGTACTCGGGCGGCATCTGCTCGCGCTCGAGGAGCTCGTCAATGCTCGCAAAGTAGAGCTCCATGTCGCCGAGCGCCTTGGAGCAGAGCGGGCAGAT
GTAGTTCGTGAGCGTGTACTCCTCGTAGCACGACACGTGCATGCAGTGGCCGCAGGGCAGGAACATCACGGGCGTCGTGGACGTGAACATATACGAGTGG
CAGATTGGGCAGTCCGACTCGAGCGACCGCTCGACGCACTTGTGCTTCTTCAGGCTGATGCTCATGCACGCGTTGCACCGGTCGCAGTGGAAGTAGTCAA
TATCGAGGCCCTAGCAAATGGATATAACAACCGCTGGAGATGAGCTATCCAGTCCTCAATCACCAGAGCATGACGAAGGGCTTCTTACCTTGCCAATGCG
GCAGATCTTGCACTTGTCGCAGTGGTAGATGTCTTTGGTCGGGTCGTCGTCGAAGAACTTGCACGTCTCGCAAAAGTACCGACCAAAGACCATCTTGCAC
TTTTCATTCACACACTGCTTCGACACGGGCTGCACACACAACAGACAAAGTTTAGCATTCGAGTTAGAGCTCAGTTTAGTACCAACCAGTAGAGGAGATT
GATGAGTTGTGTACCTGAACAGTCTCGCACTTCATGCACGAGATCGTCTCGGTCGCGTAGCGGTCGATCGCGTGGCTCTCGCTCTCATCTGCAATACAAA
AATCAGATGATGAGAAAACCAACTTCGCCATACACAGGCGAGGCTGACGAACTCACCGTGGCAGAAGCGGCACGTGTACCATTTGCCGCAGCACTTGGCC
TGTAGCTTGCACGAGCGCCTGTCAATATCCGAGGAAGCTGTTAGTCCGTGGGCCTTTGCTCAACAGTCTTAGAGAAAGCTCGACTTACTGGTAGTGGCTG
CATCCCAACACGTTCTCAGCCTCGCTCTGTGTAGAAATCCATCATGCAAGGTCAGTAGACTCGTGATACAAACCCTATTAGGCAGGGCATGGGCGAGCAA
GAGGAGACGCACAAAGTAGGTGGTCTTCTTGCGGTCAGTCTCGCTGTCGCTCTCCTGGCGCTTGAGCACGACCTTGTCGCGCGAGTCGTTCCAGTTCTTC
ATCATGAGGTTCTGCACAGACTCGGC