Description :
From Genome Similarity Track
Location :
Scaffold_1133:3165- 4622
Transcript NameFunction/comments
Phymu_g12791hypothetical protein
Phymu_g12792PREDICTED: uncharacterized protein LOC101782666

Sequence
1457 bases(100 bases per row)
AAAAGGAAAGgctcgcgcagcttcaaAGACTGCGTCAGCAACTTGGTTTGAGTGGTACACGAGAACTCCTCGGCTGTGGGAGGTCTGTGATGATCGGCAG
TACACGTCTCAGTCAAAGCAGATTGTGGCATTCATGAAACTGTTCTTACCTCACGGCTTTACCCTTGACCCTTCCGACGACCAGTATGCTGACCGCGTCA
TGCAAGCAGGGGATACAGCCCAGACGAACATGAACGCTTTTCTTCATACCCGAAACATCAAGCACAAGTACGGGTCTGGTCTTCTGAAACAGCTCCGTGT
GCTTCTGCGCGATGGAGCactcgaagaacttgttgcTGAATTCCGTGCTCGCCTAGCGGTAGGCCAAATCACTGATCCTGCACCTGAAGAAACCAAAGAT
ATGTTCTTAgtgtagtacatgtactacctCTGGTCGGAAATGATGGACAAAATGCTCATAAGCAGTCGAGGAAATGATTCACAAATCAAAATTGATAATA
TCGAGTTGAACAGGTATTAACTAACACTAAAAGAACATAAGACTTGGAcatccagcttcttcaagaaaaGCCTTAGCACTCTCGTACATGCCGAGATCGC
ATTCGCAGCTTCGCTTTACCAAGGTGAGGTAGTCCGTATTGGTTTCCACCCTTTTCGCGAAGGGCGCATACCATACAACTCTGCAGTGTCAGGAAAACGT
TGTCTAGAGATTCAACACTCATCTTGTCATAAGCATCTTGAACAGCCGTAATTAGGTTCTCGATACCGTGTACTGGTAGTCGATTCTGGATGGATTGAAT
AACGTTGAATAATCCCAGATCTAGGACGTTTAGATCAGGCGAGTTGGGGGGTTGGAACAGTAACCGGATGCACCATCCGTCTTTATGCCCCTCTGCTACA
ATGTCAGGGTCAGATGGGGAGACATGCGGTCTCGCATTGCCCTGCTGAATTAGGATAGGGCATCCACGGTCTCCTCGCGGTCACTGTTCCTTAATGGCTG
GAATAACAAGGCGAATAAGATAGTCTTTGTAGACATCACGGTTAACAACCTCGATATTACGAGAACAAGTTGTACCTTTGGGCCTGTTGCAGCTACTTCG
CTTGGCGACATATTCTTCAGTCAGCGGCCATAGACCAAGTTTTCCGTTCCATGTCGACTTCCGATGAGGATCATATCTACATACCCATACAAAAAACAAA
TGTCAAAGATCATTTAAAAACATAAAATATAATTTGTGAAAGGTTTTACCTTgtgtaatgggtctacttagacccactaggtggcgtacacgtgcgctta
cgtgtatgaggaagcgtgcaattagttNTTCCTTTCcaacctctaacagttatcctaactgttagagtttcaagtgataacaatcacttgacgtgtaacc
ccgttacaccTTGGGCGCGCGACGGCCGCCAGGAACATTGTCTTGGGAATGAAGCGC