Description :
From Genome Similarity Track
Location :
Scaffold_36:316436- 328215
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08287Hypothetical protein
Sappa_CBS223.65SPRG_08288Hypothetical protein
Sappa_CBS223.65SPRG_08289exonuclease 1, putative
Sappa_CBS223.65SPRG_08290cysteine protease family C59, putative
Sappa_CBS223.65SPRG_08291cysteine protease family C59, putative
Sappa_CBS223.65SPRG_08292Hypothetical protein

Sequence
11779 bases(100 bases per row)
TTGGCAGCAACGAGGGCCTGCGTCACCTGCGCCGGTGGCAGCGTCAATGGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCAGGGCACTTGGCATGAGCGACGCGCTGTCTCTTTGACTCGT
TGTTGGTATCCACGAACTGTCTTGCGAGGGAATCGCTTTGATTGGCTCAAAAGAAAGCGAAAGGAATCGGATTGGCTAAAATTCAAACGCTTGCATGTGG
AATGTCGCCTTCAACCAACGGAATACCCTTGCCTTCAACCCAGGGAAGAACCTTGCCTGCAACATGAATCGCTTCTTGAGTGTACGTCAAGATATCCAAG
GTAGCTAGCGCACCACTATAAGACTAGGATCAGAACTGGCATACAGCGATGTCCAAGGAGTTGCCCATTGGGCTCTACAGGAGAAAGGTGAATGTAAATG
GAAGTGAGATCACTGCATACGGTCTTGGGACAGCGCTGAGCTTTCTAATTGACGCTCGTTGGCTGTCGCGATGATGCTTGGTGGCGGCCGCGTATGCATA
GTTGCTAGAATGCGCGGTGGGTTCTGGCTTTGTTTGGTTGCACTGATGCCGTTTCTAAAGATATCTCGAACCTCTCTCGAGCTTTCTCCTCCTTCACCCG
GCCTTCTTCTTCTTCGAATGACTGACAGGGCTCATGTTGCGGGCGTCCGCCATGGAGTCGTTGAAGCGCAGACGATGCTGCTTCTTTAGCAGACACCGTC
TCTACAAATGCGAGACTGTAGCCAGGTACAAGTCGACGCCCGTACAACGCTCGATGCGTCGCGAAATGACGCTTCGACGCATTTTCAGTCGACCTTCAAG
CAGCACGAGGAGGCCAAATATGCAGCTCTTGGAATGCCAGAATTAGAGTAGAGCTGCAAAACGATGCGTCTTCTCGCATGAGAACGCTGTACGATGTTCA
GCTGCAATCCCCCTCCTGCAGATAGTACGAGTTTCATCCATGTGCGTGTCTTTCTCTCATTGACTGAACCTCCCAACCTGGTGCTCGGTCATCCCAAAGC
CGCGGCCTTGGAACCCGGCACCACGGACGCCAAGAACATCGCGCCCAGTCGCAGAGCCTATGCTTCTCGTCGGCAACGTCGCTGCCTGTATCTCGTCGCC
TCAGGACAAGCACGTGCACGTGGCCTTTCTATTCGCTGGTGGGAATCTCGTCAAGGTTGCATTCCGACGTGGACTGAGCGTCCAGCATCACTCGCTGCTT
CCTCGCTGGCGTTAACTGCTCTCTTCTACATACGCTGTGGCTCCTAGGCTATCCAAGGAGGGCCTGAGTTCTTCCCTTCTCTCGACCGGCAACGAGCGGG
CGTGAATTTTTGATGACGATCAGAAAATACGTGGCACACGGAGGCTTCTCCTGCTTGCATTTCATTGGCTCACGGATCCTGCATCCACCAATCCGCGACG
GCGAAAATTTCGAAGCTGACACGCTGGCTTCCACAATCCCATTTCCGATCTGGTCGTCCAAGACACAACGGATGAAGACCACGCTCGTCGTCGCGACCGC
GCTGGTAGGGCTTGCCACTGCGCAGCAGCCGACCACAAGCCAGACCTTCCGCGGTACGCTGCTCCACGCGACGACGGCGCATCATCATCTCATCCAACTA
CGTAGTCTGCCGCCATACCAACTACGTTGCAGACGGCAACAAGATCTACGCGGTCGACCCAGCCAACCCATCTACCAAGACCGAGCTCTTCATCAAAGGC
GTCACATGGAGCGGCATGGAGCTGCCGAAACAAGGCATTCCCATGGGTCTCTGGGGTGCCAACCTCACCCAAATCGACTCGGGTATCAAGGGCACGTCGC
TGTCTGCCATGATGCAGTTCATGGCCAACGCGTCGATCAACGTCGTGCGCTTCCCGCTCACGGCCGACGCGGTCGTCAAGGACACGCCGCCCATGGTCAG
CTACGTGCACGGCGAGAACAAAGAGATTGCACTGTACCCGCCGGGCTTTGTACCTCGCACGTCCGACTTTGTCGCGCGGCTCATTGGTGCGTTCCAAAAG
TACCGCATTGGCATCGTCCTCGACGTCCACGACCTCGTCGAGAACTTTGCCGTCGACGCGTACTGGTACTACCCTGCGCCGTCGACGGTCGAAGAGAGCC
TCGCGTACAAGGCGGCGGTCGTGCTCGCGACCAACTACTGCAAGGCCACGTACTGGAACGTGCTCGGCATCGACCTCAAGAACGCCATGACCGACGTCAC
GTGGGCGAAATCAGCGAGCGATGCGCGCAGCGTCTCGGACTGGGCGTCGGCCGCGCAGGTGATTGCGGCCAAAGTCAACGCGCTCTGTCCGCAATGGCTG
GTCTTGACGACCGGCGCGAGCTCGGCGAAGGGCGAGTCGTTCAGCATCCCGTCGCGTGCCAATGAGACGTTTCCATTTTGGGACGGCGGCAACTTTCAGA
ACGCAACGGACCGGCCGCTTCAAGGCGCCACCAATGTCGTCTATGCGCCACAGGCCCACGTGCACGGCATGCTGCCACAAGCGTACTTGTATGCCAAGGC
CGCGGGCTGCGGCAGCAACCTCCCGACGACGCCGGTCAAAGAAGACACGACGTGCTCGGTCTTCTTGAATGGCTCGTTGGTGGCCAACACGAAACGCGCG
CTCTCATGCCAGAACTCCAAGTTTGCGTGCGCTTCGTACGTCCCGATGGCGATTCCCGAGCTCCAGGCGAACGTCGCCGCGATGCTCCAGTCGGCCCTCG
GCGGCGTCGTCGCCGCAGCCACGCACCCGATCGTGTTCAGCGGCTTCTCAGCCGTCTACGTGCCGTCGTTGCAGCCGCAGCAGGCGGCGGCCTTTGATGC
GATCTTGCAGTTCATCGTGCACAACACCAGCGGTGGCTTCTACGCGAATCTGAACCCGGACATGGAGATGTACCTCGAGGCGCCGCCTGCCGGCAAGACC
ATTCTCGGCAAGACGCGGTTCGGCCTCATGAAGACCAACTCGTGGCAGGCGGCCAACCAAGAGCTTCTGGATGCGCTAAGCGTCATGAAAAGCACGCCCA
TCCCGTGCTACGGCGACGTGCACCCGGGACCGCCCGAGAATGCTGCCAACGCGCTCGCGCCGGCCCTTCTTCCATTTGTTGTTGGTGCACTGGTGTACTG
CTGGTCGTAGAGAACGCTCATGGATGTTGCATAACATGCATTGTATTGGTTTGGACCATGCTTGCGTTCGACGTTCCGATGGTCTTGGGCACAAGGCCTT
GCATCATTAGTGCTGCGATTCTCAAAGAAGAGCCCGCTCGGCGCCGAAGACATGGGCTCCAGTACGTTGCTGCCGCATGGGCATGAAGAAGGGATAGAGC
GCGTGGTCGCTGCCATGGGCCATGGATCCTTGTCCCGCACATGGGCAGAGTCTGCGCTGCGACCGAGTTGGTCGCCTGGCCGGTGACTGTCGTTGCTCGG
AACAAGTTGAGCCGACGGGCCTTGCGACCGTGTGGGCCAAGGTCGATACGGTCCATGATGGCCAAGACGCGACGTACCAGAGAAGGTTGCCACAGTGTCA
TCTCGTCGAGCTTGAAGTAGGAGTGGGACGACATCATGCAGCGAGCCTCCGGCGGTGGTAACGTGCACCTCACGTTCGGAGGTCGGTGGTCAGTGGTCGG
TGGTATCATGGCGCGTGACGTTCGCATTCGACCGCTGTATATCGGTGCCACGAGTGCTACCTCTGGGCACTGCGCATGTGTCCCAGCGCCGTCGTCGTCG
GGCTCCTGCGCGTGGTGGTCGGCGCCAGGTCGGCGCCAGGTCGGCGACCGCTTCGCCCAACGGCCTGCAGCTGCATCTTCTTGCCAGGAGGCAGGAGCGG
TGCAGTGGTCGAACGCTGGCGACGCTGCGGCTACCGAGCCCACTCGGCCAGTCGCCACCCCGTTACGCTTCAACGTCCATGTTACTCACCCTGTCTTGCA
GTATTCTCTGGCGCAGCGGAAGCGGATATTGAGCTTGAGTTTCAGCCTGCAGTCGCAAAACGTATGTCTGAAAATCGAAGGAGTGCGCAATTGAGGTTCA
TCGATCCGATTGAGTTTAGTGCGAGAGAGTAAAGTTCGAAAGCGTGGTCTCATTATTCTTCGTGCTCGGCAGAGTCCGCCGCCGCCGACGAGCCAAGACC
ATGTCTTCGTACCCAACGACGACTGCTCCGACAACGACGCCTTCCACGACGACACCGTACTACGCCAAGCCCGTCATGAAGCGCAAGCGCGCGCTCGAGG
CGCTCCCGCCCGCCAAGAAGGGCCTCACCGACTCGATGCATGCGACGCTGGCACTGCTCCAGCACATCCCCGCGCTTGCCACGTTTCCGCCCGGTCGTCG
CGCCACGCGTCGGGGCGGCGTCGATGCTGGCGACATGATGATCCACGCCCTCGGCGCCGTCATGAGCGCGACCCAAGTGACGCCGATACCGTCCCGAAGG
CCGACGTCGGCCACAAAAGAAGACGAGGCGCGGCCATGCGCCAACTCGTCGTGCTGATAGTGCAATAGTCGTCGAACCTGTAATATGAAGCAACACCAAC
GTACTCACGTCCATGCATTCTACACAGCGCGGGCCCGCTTGGACGCTGGCGCCTCTTGGTCACCGCGAGGTCGGGTGCGAGCGCCGACTGGCTCGGGCGC
GTGCGTGTTTGGGTTTAGCGACCCGTTCGCAATTCCAACAACAATCGCATCGGGCAGGTCGACGCGGCCAAGACACGAGAGGCTGCCGCCATGGAGCGCC
AAGACCTCAGTTGACGCACTCAGCGGGTTGAGCATGCGGCACTTCTATAAGAATGCATGGGCTTGCAGAGTCCTGTGACGATGGGACGTGCGCACCTGAC
GGGTCTCATCAAAGACCAAGTGGTGGCGAAACGTGAGGATGGCCTCGAGGTACGCTCGCCGGAAAGATGCTGAGAAGTCCTTGTACGTTGCTTGCAGCGC
CGCGAGGATCTACTCGTCGCCGCATGAGACCGTCGTCGTTGTCGTCGTTCGGCGAGCACCCGCGTTGGCGTCCGGTGGGTCTCAACGAGGGCGTGGGCCG
CGACGGGCCCGACGCCCTTGAGTGTCGGGCAATAGTCGCAGCCAGCGAGGATGCAAAACTGCACGAACTAGTACGTCGACGGGACCATGGCACCGCAGGT
CGCAATGTACGAGGACTTGGTCGTACCATGTCTTCGCTCCAGCCCGTGAACGACATGTCTTCGTTCGCGCCCATGTATCGCCGCCGAAACTCTTCCCCAT
ACCCGTTGTTTTCGAGCTTGAAGAAGACCTAATGCAGCTCGTGGCGTGCGAGGCTCTCGTTATCGGTACCGTCTTGCAGCCATACGGAATGCAGTCGCTG
TCTTCGGAGAAGACGACGTCGACGAGCTTTTCTTTTGAGAGCAAGGCGAGCTGCGCGTCGGCCTCGTACGGCGCGACCAGGCATCGTATGTTCGGGTACT
TGGCGCGCAGCGTTACGAAGAGCTTGCGCGCCATGGCCCGCGTCACGTGCAGCGCCCGGCAGAACGCCGAGAAGCTCTTCTACTCAAGTGCCCATGATGA
CACATGTAAGAAGAATACGCGACGTACGCCCGAGTCGCCGGCGGCGTGGAGCTCGGCGCCTTGTCGTCGATACGTCTCGCGGGTGCTACACGGGGCGTGA
GAGACGTCAGCAACGCAAGACGTACGCGCGGCGCTTTTGATTCGTTGCCGCTTTGGCGGGCACGGTGGCCCCGTCAAAGACGAAGGTCGGCGTGATGTCG
TGCTCCAGCAGCAGCTCGAGACGCGCGAGGCAGTAGCTGATGTACGGCGCGGTCGCCTCGCCTTCAATGTACTCGCCGATAGGATCGCTCTCGAGCGTGC
CAAGACCGAGCTCGACCACGCACGTGTACGCGCCTTTGTACAGCCAGCCCGAGGCGTCGATGGCCGCGCGCTTGCCACGGTACCTACGCCGAGATGAGCG
TGTCGTGGCCATGGTCCATGCAGGTACTTGCTAATGTGCGTCATGGAGATGATGCTCTTGAGCTTCGGAAGGAGGTCCGACACGCCCATCGTCCGTCCTT
TCACTCGAAATTGGCCGCTGTGCAGTTGCCGGAATTAAGGACACTATATGTGGCTACAGATGGCACATGCCACATATACAAGCTCGAGGGCGGGCTTCAA
GCCAAAACGAGGCCGCCCGCCATCGTGCATGTAAGAGCACAGGTATTAGTCCCTAGGACGACGTACATAGCTCAAGAGAGCATGTCGTCTTGAAGCAGAG
AGACAGCAACGCGTGCCTGGCGCGAGGACCGGCGGGCTTGTCTATGGCGCCTGCGCCGCGCGCACACGACGGCATCTTGTGCACGTGTACCAAGGCGCCT
TGATGCTCATGCGACTGCTTGCTGCTGTCGCAGCGGACCAAGGTCGATACCAAATTGGTGCCATTTCCATTTTTGTCATTCGGACAGGACGTCTGAGCCG
GCGGAAGCAGATGGCGGTGGGTGTGATGACCGCAGCGTAATACGCCACGTCATTCCGATGACGGCGTAACTCGCGCGTGAACTCATCACGCGCGTCGCTT
GTGCACGTGGCATCGTCATTCTGTCTTTTCCACGCTCGGTCGACGATGCGGTCGTGGCTTCTTTCACTCTTGCCGCTGGCAGCGATGAGCTGCAGCGACG
TTCGTCTGCACTCGGACAAGGTCGGCGTCGTCGTCTCGGCGCGGACGATGGACTTCAACTTGGATCTGCAGAGCACGCTTGAGATCGTGCCGCGCGCGAC
GCTCATCCAAGAGCCACTGGCGAAAGACTGCACGTCGTGCGCCGACTATGGCTGGCGCAACCGGTATGGCTTTGTCGGCCTCAACATGCTCAGCCTCAAC
GTCGCGACGGACGGACTCAACGAGGCCGGGCTCTCGGCGGCGTGGCTCTACCTCGTCGGCACCACGTACCCGACACCCAACATGACGGACCCGCGGCCCG
TTGTGACGTCGGTCATCACGTACATTTTGGGCAACTACGCGACTGTCGCCGATGTCAAGACCGGCTTGGCCAGCATCCAAATCGCCGAGCCGCACCCGGG
CGTGTCCAAGCTCTTGGGTACAGACTCGGGGTTCCAGTCGCTGCCGCTGCACATTGCCGTGCACGATGCGGCGGGTGAGAGCCTCGTGGTCGAGTTCCTC
AACGGCACCGTGCATATGCATGACAACCCGAACGGCGTCATGACCAACGCGCCGCCGCTGCCAACGCACCTCGCGTCGCTAGCCAACATGGAGAAGAAGA
ACGCTAGCCTCCCGGGCGGGTACGACTCGGAGTCGCGCTTCTTGCGTCTCTCGCTACTCAACGACGTCGTGGCACAGCCGTACTTGGCAGCGACGAGCTA
CAACGCGTCGACACCCGAGCAGGCGAGCATCTCGGCCGCACTGCATCTCATTGACACGGTCACGATCCCCGTCGCCGCCTTGCGCCAAGGCGGGTCCACG
CAGTTTACCGTCGTGCGTGACCACGTCCAGCGCAAGCTGTATGTCAAGGCGACGCAGAACCAAGTGCTCCGCCTCGTCGACGTCGGGTCGCTCGACTTAA
CGAACGCTGGCCTGCGCAAGTCGATTCCCGTGACGTTTGGCGACTGGTTTGTCAACGTCACGGACGCCCTTCTCGCCGCGACGGGCCACTCGAAGGACAT
GCCGCCGCGCAGCTTCGTGGTCGCTGCGCTTCGGTCGGCGCCGGCCAAAACGCAGCTTGCAACGCATGCAGCTGCAGACCAGTCGCATGCGCTGACCTTC
GCCCTCGGCACAATCGTGGGCATGACCATGATGGCGATCGTAAATGCGGTGGTGGCCAAGTACCGTCGCTACACGTACGTGTCGATTCAATCATAGACAG
AGTTGTCCTCGTCGCTTGTAGCTGGATGCGTACAATTAGCTAGTATATTCTACTAGTATAAATGTGCCATCGACTTCGGGAGGGTATATGAAAGACCGTT
TTGACATGGCGGCACACACGCCAGAGAAGATAGCCGTGCACCACTCGTTTGTCAACCACTCGTGCGAGGCTGGCAAGATCAAGGATCCCGGCGCAAACGC
CCTCGAGCTGGGTTGATGGAGCCTTCTCGAAAGGTACTTATACGCATCGAACGATCGCCACTCTGGCGTCGGAAGGGGCCGTGCATGAGTCATCACCGCT
CACCACGGGTGCATTCTCTGCAGATGCAAACGTCTCCGTTTTTATCGCTTCACAAAGTTGCCATGGCCGTCGCTTGCTGGTTCTGTGCGGCGTCGTATTG
ACCACTCGTTGGCAAGTTGAAGTGGGCCGCCTGTCCTATCCTGCTCGAAGCAGCGGTTGCGGCCGCCAAACCTTGACGTTCGATGCTATCACGGTGGATC
TGCACCGTGTCGCACGCTCAGATGCGAGGCCAGACGCAGTCCGTCGATCCCGCACTTGGCGACGGTATCTTGGTGGCGATCTTCCTGCGTGACTGATGTG
CAAATCCATCTGCGACATGTGGTATATCCATTTTTCAATGGGACCCAGTGTACCCACAGAAATTTTTCGACCCCTCTCGGCCCAAGCTCTTCCCACCCTT
TTTAACGACTTGACATCTCGCTCTAAAATACTTGGCTTGGAGCTTCAGCGCAGCGTCAAAGGACAGCAATTGCCTGAAGCCGCGTGCGGTCATGGTCCAA
CGTCCTATTTTTCGGGACCCCGTGGGGGCCATAAATATCACTCGTGGCGTTTCATCGTGTGCAAAATACTTAAAAGACGCAACTATGACTATTCCCACGC
CACTTCATACAAATATGAATATCACAATTCGCTCGTGCAGAGCCAACGGCCTGTAAAGTGGCGTGGATTTAGCGTGTTGGCGATCCCCACCTTTTTCACG
TTGCAGCTGTGGTCGTAAGCTCGGGCCAGTTTGCAATTTGAATCTTCACATGCAGGTGCTCAAGACAGTCCTCCTGGTCGCGACCGTCGTCGCCGGCTGC
AGCGAGTTCCGCCTCAACTCGGACCGCAGCGTCCTCTCGGCGCGGACGATGGACTTCCAAATCGACCTGGACAGTACCGTCGAGATCATTCCACGTGGCA
CACTTGTCGAAGAGCCCATCGTCAAAGATTGCCCCGACTGCGCCGACTACGCCTGGACGACGTCGTATGGCTACGTCGGCTTCAACATGTTTGGCGTCAA
CGTGGCCACAGACGGGCTGAACGAAGCCGGGCTCTCGGCGGCGTGGCTGTACCTCGTCGGTACCCAGTACCCGGTTGTGAACGCATCCGACCCGCGCCCC
GTCGTCACGTCCTTGATCACGTACATCCTCGGTAACTTTGCCAGCGTCATCGACGTCCGCCGCGGCTTGCGCGACGTCCAAGTCGCCGAGTTTGACCCGG
TGCTCGGCTCGCTCTTCTCGCACGGCGCCCGCGAGTCGTCGTACCCGCTGCATGTGGCCGTGCACGACGCCGCGGGTGCGAGCCTCGTGATCGAGTTCCT
CAACGGAACCATGCACCTGTACGACAACCCGAACGGCGTCATGACCAACGCGCCGCCGCTGCCAACGCATCTCGCGACGCTCAAGGCCAACGGCGTCGAC
ACCGTGCCGGGCGGATACGACTCGATTGCGCGCTTCCAGCGGCTCTCGGTGCTCAACCACTTTGCCACGCAACCGTACAATGCCAACACGAGCTACTCGG
CGTCGACGTCCGAGCAGGCCGACGTCTCGCTGGCGCTGCACCTCATCGACACGGTCACGATCCCAGAGCCAGCGCAGGCCCATGGCGACGCCACGCAGTA
CTCTGTCGTCCGCGACCACACGCGCAAGAAGCTGCACTTCAAGTCGACCGAGAACCAAGTGCTTCGCACCATCGACTTTGGACAGATTGACTTTAACGAT
CCGTCGACGCGCAAGTCGCTGCCCGTGACCTTTGGCAAGTGGTTTGTAGACGTGACGCAGGACGCGCTCGCGTCCAGTGTCCGCTCGATCGACATGCCGC
CGCGGTCGATGGTCATCGCCAAGCTCCACGGCCTCGCGCAGCAGACAGCACAGCTGCACGCCAACCTGGATACGCTGCCGTCGTACGTACATCCGGACCG
CACGGTCGCGAGCTTCCTCATGGGCGCCGTCGTCGGTCTCGCATGCGCGGTGCTCGGCGTCGTCTGCTACCGAGCGTACCGCCACCGCCTCGACCACCAC
ACCAAGGAGTACGTGCACTTGGCCTAAGACTAAGATACACGTAAAACGAGCGTCAGTTTTGTGTGCAATTTGGACTTGACAGCGACGACCATGACAGCCG
CTGGCGCACCCGTGGTCGGCGGTAAAAGCACGACTGTGGTTGTCGCCGGTGGTAGAAAGAAGCCTCTGGTTCGGATCTCACGGAGCTTTTCAACAGCGTG
CCTCTGTTGAATGCGCCTCGTCGCAGCCAACACCCTCCAAGCCTGTCGCACGCGCTCCTCCACGACCTACCGCCCTGGTGATTGAAGAGCTTTAAAGAGC
AGAGGGAACGGGGCAGGACCTGTCACATAAGAAGAAGGTACTCTGAAGCTACGACATGAGAGTGGAACATGGCCAAGGCGACTACGCTGGACGAGGAGCT
AGGACCATCAAGATGATGGCAATGCTAGCAAGGGTGGGCCACCTGCGTCAACATGGTGTATCTGCATCCGCTCCGTGGCCAATCACGCGCGAGAAGACGA
TCACTCTGCATGGGAATGAAGGGTGTTTTGGGGATTGCCTCATAGCGCATTTGCCGATTGGAGACGTGAGGATGATGCACGGTCTGTGGCTTGTGGCGCT
GAGCGTCGTAGCCGCACAGGGCTGCAGTGACTTCCTCTTGAACAGGACGAACGAGACCATCTCGGCGCGTACGATGGACTTTACACTCGACTTGAATGCG
CACCTGGAGATCGTACCGCGGGGCACCCGCCTCCGAGAGCCGCCGGCGCAGAATTGCGCCAACAACTGCAGCAGCTACGCGTGGGACGCGACATACGGCT
TTGTCAGCGTCAATGCATACGGCGCCAACGTGGCCATGGACGGACTCAACGAAGCTGGGCTCTCGGCAGCGTGGCTGTGGCTCGACGCGACCACATATCG
CACAACCGACGCTATGGATCCTCGGCCTGTCGTCACATCGGTGGTGTCGCACCTCCTCGGTACTTGCGCGTCCGTCGACGACGTCCGCGCCAAGCTGGCG
ACGATCCAAGTGGCCGAGATCGACCCGACACGCTTGATCATGTTTGCGCCGGGGACACCGGTGATTGAGTCGTACCCGCTGCACGTCGCTGTCCATGACG
CATCCGGTCGCAGCCTCGTGCTTGAGATCTTGAACCAGACGCTGCACGTCTATGAGAACCCGAACGGCGTACTCACCAACGACCCGCCGCTGCTGGACCA
GTTGGCGGCGCTTGCGAGCGCCACGTCATTGCCGTCGGGCTATGGCTCGACCGAGCGTTTTGTGCGTCTCTCGATGCTCAACCGCCACCGAGACCGCGTG
TACGACCCAACGACGAGCTACGGCGCGGCGTCGAGCGAGCAGGCGGCCGTCGCCTCGGCCGTGCACTTTCTAGGCACGGTGCAGACGCCGCTGGCGGGCG
ACAACGGCGGCGGCACCGAGTTTGCTCTTGTGCGCGACCATGCGCGCCGGAAGCTCTACTTTCAGTCGACGCAAAACCTCAACTTGCGCATGGTCGACTT
GAGTCGCATCGACTTTGCTCCTGGCGCCAAGCGACGAGCACTCGCCGTGACGTTTGGGCGCTGGGTTGATGACGTCACG