Description :
From Genome Similarity Track
Location :
scaffold_57:31643- 34971
Transcript NameFunction/comments
g2324.t1 hypothetical protein PHYSODRAFT_262310
g2325.t1 hypothetical protein PHYSODRAFT_511420

Sequence
3328 bases(100 bases per row)
TTTACACAGTAGGCCAACCACTCGAGAAGTCAAGCTTGTTCCAACCAAAGCGCTTGTCGCCATCCGCGTACCCGATGCGAGTGTCCACTTTTGAAACAAA
CAGAAAACAATTGTGAGCTATTGAAGACTACAGAGAAAAGTAGGACACAACTTACCGTAGTGGTAGTACAGAACGGGACCATACTTCGGGTCGTTGTACA
CGCCCTGGCCTCCCGGACCGTAGACCCAGTCGTGAGACTCAAGGACGACTGTACCGCCATTGTTACGGCAGTCAGCTCCATTCTTGTCAACAAAACCTCC
AGTCGGGCTCTTGGAACGGCATGCGAGGATGCGGTACTCCTTGCCCTTGGCAGGACGGGTCTTGTCATAGCCACAGCACGATCCCTTGGAGAAGAAGAGG
TAGTAGTAGCCGTTGTAGGCGAACTCGAACGCAGCTTCCAGGACCTCGAAGTTCGAAGTGAAAGCGATTTGATAAGCGCTTTCACCGGTGCTTTTCTCCG
GCAGCGACGTCATTTTGGTTTGGTGGAGACCCTGCCAGTAACTTCCGAAGTTGAGGTAGTACTGGCTGCCAACCTGAATGAGGTTCGGATCGATCGCGTT
GTACTTTTTGGAGGCATCGCTAGTGACCCCCACGCTGCCCGCATCGACCCACGAGCCTGCCTCCATCGTTTTCGACCGCGTCAGACCAATAGCCGAGTTC
TGAGTGCCGAAAGAGCTGACTGAATAGTACAGATAGTACGTGTCGCCGACCTTGTTCACCTCAGGAGCCTACATGCCGGATGTTAGTGCACGTTAATTCT
GGTAACATAATCAATATCTTACCCAGAGATCGTCCTTCCCCTTCAAGTTGATCTTCGAGCCGTCCGGAACCGCAGCACCGAGATATTTCCAAGGTCCCGT
AAGGTCAGGAGCCGAGTGGATAGCAATTTTGTTGCCCGTGGAGAAGCGGAAATATGTGCCATCATCTCGACGGATAATGGACGGGTCGTGTGCGTTGGTG
CAGACTCCTGTACAGGCTTGAGGGTTGGCGTATCCATTGACGACGCCAGCGACGAGGAGCGGGAGACCGACGAGCATCGAAAGGAGCTTCATAGTGGTAA
ACAAATGCTGAAGTCGAACTGTGTGCGTCGTGGCAGTCAAAATTGGGAATGAAACTTTGAATGGGGATACCTAAAGCAGCTCTGCAGTCCATCCCAGGAT
ACAGGCAAACGCCGCGAAGCGTGTGGCTGTTGACTCATGTTGGGCTTGTCACATTGCAGCGATTCTTGATTCATGCATTGTCGATAATACATGTACAGCC
TCGGTCGCCGTTCCAACAGATCCGACGTCAATCTGCTTCAACATTCGGACACATCAACAGCCGCGTTATGTGTGGAATTCAGTTCAACGAACAGAGGTCG
AGTAATATCCACAAAAAGCAGTAAACTTTGCGAAAGATAATTGGTACTGCAATTTCTAGCTGTTTTAAATACTTGTGTTTGTTACGACAAACACAACGGT
AGTACATGTACAGAAGTACATGTATAAAGCCGACAATACAACAGGGTGCTAGCAAGAAGAACTGCTCGTGTATATACTGTACATCGCTCGGTGTTTGCCA
AGCACCACACAGCAAATCCTGCTCTAGGATTGCTTTTGAGAGCTGCTTCGTGCCATCGCAGTGGGTTCTGTAAACTCGTTTTATTTCCACACTTGAAAAT
ATTGGAACCCGTGCGGTTGGAATCCAACCGTTGGATCGTACACGCTGAAAGCTTTCGACGGTCGCAACTACGTATCGATGTACAACTGCACGGCTTACCA
GTCATCTTTTTCGGAATTTGTAAAGATGACGTCTCGAATCGCACTGATGCAAACAATTCAACCAGAAGCGTAGCGCAGTAAAGCGCAAGTCCATGGCAAA
GAGCAATACGGCTCTGGTGCTTACATTTTCTCTTGAAACAGATATCCCTGTTCATATCTGTTGTACAACAGTGAATTTACGTTCATGTTGCGATCAAAAC
TTCATGTTGCAAAATCGAACATCTTTCACGAAACATTGCTCTAAAACACCGACATCTAGGTCTGGCTTTCTTCCAGAAACTTCATCTACTACTCTCCGTT
GAGTATTTAAACCTTCGGCCAGCCACTCGAGAAATCGATCTTGTTCCAGCCAAACTTCTTGTCGCCATCCGCGTAGCCAATACGGGTGTCCACTACAAAT
TCAAAAATCAAATAAACTCGTCAGAACGAGCCCATGACGACCTAAAATACTCAAAGCACGTAGCTTACCGTAGTGGTAGTACAGAACGGGACCATACTTC
GGGTCGTTGTACACGCCCTGGCCTCCCGGACCGTAGACCCAGTCGTGAGACTCAAGGACGACTGTACCGCCATTGTTACGGCAGTCAGCTCCATTCTTGT
CAACAAAACCTCCAGTCGGGCTCTTGGAACGGCATGCGAGGATGCGGTACTCCTTGCCCTTGGCAGGACGGGTCTTGTCATAGCCACAGCACGATCCCTT
GGAGAAGAAGAGGTAGTAGTAACCGTTGTAGGCGAACTCGAACGCAGCTTCCATGACCTCATAGTTGGAGGTGAACGCCAACTGAGTTGCCACTTCGCCC
GTGTTCTTCGTAGGGTTGGCCTTCATTTTGGCTTGGTACAGGTCCTGCCAGTAGCTTCCGAAGTTGAGGTAGTACTGGCTGCCCACTTGGAACAGGTTCG
GGTCAATGGCGTTGTATTTTTTGGACGAGTCACTCGTGATACCGACACTACCGGCATCCGTCCAAGTACCCGCGTCCATTGTCTTAGACCGGGTGAGACC
GATAGCCGAGTTCTGGGTGCCGAAGGAGCTCACGGAGTAGTACAGGTAGTACATATCACCGACCTTGTGCACGTCAGGGGCCCAGAGATCGTCCTTCCCC
TTCAAGTTGATCTTCGAGCCGTCCGGAACAGCAGCGCCGAGATACTTCCAAGGTCCCGTAAGGTCAGGAGCCGAGTGAATGGCAATTTTGTTGCCAGTGG
AGAAGCGGAAATATGTGCCATCATCTCGACGGATAATGGACGGGTCGTGTGCGTTGGTGCAGACGCCCGTACACGTGAGGGGGTTGGCGTATCCGTTCAC
AACGCCGGCTACAAGGAGCGGCAAACCAACGAGGATTGAGAGGAGCTTCATGGTGCAGATCAAGGAGGAGGAAGACGTTGCTGTCAAAAGCGAAAGTGTG
CAGTTACAGAGCACAAAAGCGTTCGAACACCACACGCAGTGCCTCTGCCGTTGGCGTGGCACACTTGATCGCGTACCTGCCAGCTGAATTTGGAGCTTCG
GCTGTCAGTGGATTTGCTTGAGCTCGAG