Description :
From Genome Similarity Track
Location :
Scaffold_510:3163- 4720
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_510-snap-gene-0.6Lipoprotein, type 6

Sequence
1557 bases(100 bases per row)
CCGGCCGCGGTCGAGCAGCCGCAGCCGCAGCCCGAGCCCGTCGAGGTCGAGATCCCGGACGTGATCGAGCGCCTCCCCAAGCCGGACAAGGCCGCGCACG
ACGCCGAGATCGCCAAGCTGGACACCGCCATCAAGAAGCTCCAGGCGCGCACGGTACGTGACGAACGCAAGGTTTTATGTATATTTTGTCCTGAAGGCTG
ATCGTCGGTGGTGATGCGGACAGAATGTGATCCGCGCCGAGATGGACGCGCTCAAGACGGGCCGCAGCGGCTACGGCGAGCAGATCCAGGCTGCCAAGGC
CGAGTACAGCGCGATCCGCAGCGAGAAGGACAACCTGATCCAGCAGCGCAACCAGATTACGGCGAGCCTCAAGGTGGTGCACGAGAAGAAGGACACGGCC
ATCAAGACCCAGCGGTCGGCGCGCGCCAACCTCAAGTTCTCGAGCGAGGAGGAGTTCGAGCAGGAGATCTCCACGCTGCGCCACCAGCAGGAGACGCGCT
CCATGTCGCTGAACGAGGAGAAGCGCCTGATCAAGGAGATCGAGGCTCTGCAGATCCAGAAGCAGCAGGTGAGCAAGCTGTCGGGCGACGCCGGCGCTGT
CGACGCCGCCAACGACTCGATCAAGGACATTCGCGCCAAGCAGCAGTCCAAGAACACCGAGATCGACGCCGTGCAGGCCAGGCTCGCGGCGCAGAAGGAG
AAGCTGGACGAGCTGTACAAGCTGAACGACGAGGAGCGCAAGCAGGACAAGTTCCCGGCGCTCGCCAAGGAGCGCAAGGCGATCAAGGAGCAGCTGGACG
ATAAGTTCACGGCGCTCAAGGCGCTCCGCAAGGAGTTCAAGGAGGCCAACGACAAGTACTACAACAACATCCGCCTCGTGCGCAAGAAGAAGGAGCTCGA
GCGCCAGAAGGAGGAGGAGGAGCGCAAGGCCGTGTACGAGGCCAAGCTCGCCGAGTACGAGAAGGAGCTGGCGAAGATCCACCCGTACCAGGACGAGATG
GACTTGTGCGATGCGCTCGTCGCCTTCATCGAAAAGACGTTCGCGAAGGACCTCAAGGAGGCGCAGGACGGCAAGGCGGCCGAGGCTGCTGCTCCCGTGG
AGCTCGATGGTCTGAAGCCACTGCAGCGCAAGGAGGAGGACTTTATGATGCTCGGCGGTGGCAAGAAGAAGAAGGGCAAGGCGGGCAAGAAGAGCAAGAA
GGAGTCCAAGCTGTCGCTGCCGCTCGCGCAGACCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGATCGGCCTGGTGCCGCCGTCGGTTGTCGGCGC
GGTTGCCGAGTCGCTCGCGGCCATCAAGGAGAAGAAGACGTGGTTCAACGAGCAGACGGCGCGTCCGGAGGCGGAGAAGAAGGAGGCCGCGCCTGCCGAG
GCTGCTGCCGCTTCGTCGCCCACGAAGAAGGAGTCGAAGAAGAAGAGCAACAAGAAGTTCAACGCCAGCGACAAGGATGCGTTCCCGACCCTTGGTGGCG
GCGACGCCGCGGTCGCGCAGACCCCGTTCGCGTGGGGTCCGGGCATCAACCCCGCGC