Description :
From Genome Similarity Track
Location :
Scaffold_30:316224- 320903
Transcript NameFunction/comments
Physo_134175hypothetical protein
Physo_134176hypothetical protein
Physo_134177hypothetical protein

Sequence
4679 bases(100 bases per row)
GAAGGGTTGACGCCCGTTGGCGGTTGCCAATAGCGTCCGGAGATTTGCTGGTGGTACGCCGGGGGCTGCTGTGGCTGGCCGTAGCTGCGAAAAGAAGGCT
CCATGGGCGCGGGGTACTGCAAAAAGCTCGACTGCTGCTGGTAGCCCCCCGACGGCGTCGTGAATGGGTTCACAAGCGATCGGCGGGCTGCCCCACCACC
GCCCGACGACCCGCCCTGTCGAGGCTGCTGCTGCTGCTGTGACTGCATCTTTGGTGGCAGCTGGCGCGAACGGGGCAAGCCACAAGTCTGCAACTGGCCG
AGAGCGCGAGTGGGCGGAGCTACTGCGAGCGTTGGGTGGAGACGGTGGACGCGCTGATCTTGGTGTAGGTATCGTCCGCTGTTCTTCTCGCTGGTCTCCG
GGTATTGGACAAAAACCGGAGGGAAAAGCTCGCCGTGGTTTCAACTTGGAACGTGTGACCGGCGGCGAAAAGAAGCTGCACCAGCGCTCGGAAGTCAATC
GGCTGACGCTCAAAGCGATCGCGTTGCGGCTTGCCAGTTTGAGGCGCTACATGAAGTGCTAGTTGTGCAATAGAGCTTCGGTTCGGCAGCGCGTGGCGCC
GACGGCCGATTTAAACCCGAGCCAAAGCCAAGCGGAGACCGAGGCAAGTGAGCACACCTGGCATTGCCGATACCACGCGCAAGACACGAAAGAAATATCG
AAGCCATCTGGATCGGCCCGGAGAGCGTAGGGTCGGTGGCGGGACGGTGCCCTGTCTCTCCTGCTCTTTCCTCCTGCGCTTGCTGCTTCACGTCAAGAAA
TCGCTATGGTATGCGAACCCATGGTGCAGTCGACGATGCAAGCATGGCCCGCGGCGCCCCAAAGTGAGGCTTCAACGTGGCGGGCATCACCGCTGACTAC
GCCTGCGACTTTAGTAAACACCAGCTGGCGGCTTCCGCCACACAACCGCCAACTGGTTTGGAACATAGCCGGGCGAGATGCGTCAAGCTCGCGACCCCGC
TCAAGTAAACTTCAACTGCGTCATTTGTATGCTGCAACGTGGCACGAAGTCTAGGTATGAACCTAAGCGGGGTAAGAGCGGAAACCATACTTTTTCGGAA
GTACAAAACCTTGTTGTACCGTGTAAAGCAAGGCAAGTCGCGGCGAGATGGCAATGTGGATGCAGTACATTCTTTTCTGTCCAAGCGGTGGCAAGCCACA
CACACCTGGATCACCGGTACTATGATGCAACCGTTGCTTCGGCCCACTAAACCGCGATTCTTCGGCCAGATTTAAGGCCAGTCGGCAGCTGGACGCGCAT
CAGAGCCATTGGACATTGGCCCACGCTGGATTGCAGCGCTTCAAATGAGTCGTTCGTCGTATTTTCACGTACGTTGAAAGCAGAGCAGTCGGGGTTTTAC
TATTCTGTAGCATGAGTACACAGACTCGCGCGACAACATACAAATACCGCTACGTGTACCGGTGAATATTCAGTATACCATAAATTTCAAGGTGACGACG
ACTGCATTTCTATCGTAAAAATCCCGTTAGTATTAGCCACAGAGCCACAGATTCACGATGTTGGTGTTCCGCGCATCGCACCGCGCAGCGCGGCTCGCTG
AGGCGCTGTCTCCTGCTCTCCGGTCGCTTCACACGGCCTCCCGTATTGCCAGTCGTCCCGCCAACGTAGCCACGCTCCAGCGGTTCTCGCTCGAGATTAA
CAGCCGCCGCAGCGCTGGATTCAGTGGACCGTTCACTGTCCGCCACTTCAGTTCATCCCAGACCGATGAAGACGCGCGTGAGGAGAACAAGGACAAGGTG
GAGCTGAATGCTACGAACCTGGAAGGTGCACAGGTCTACCAGGCGCCTATGTCGCGTGCTGTGCGCCTCATGAAGGCGGTGTCCGTCACCAGCTGCACCC
TCACCTCGATCGGCATGCCGGTGCTCTGTGTGCTGAGCGAGCAGGACACGTCCACGATCGGCAAGGTAAGCGCACATCGACAGGGGCGTAGATAAAGCAC
TGGTGTCGATGGTAACTTGTACTGATGCAATTCGTTCTCTGTTCGTTTAGTGGGCTATGTGCGGCACCATCATGCTGTTCGGCTTGGGCACGACGTCGCT
GTTCCACTATCTGTTCAAGCCGTACGTGATGCAAATGTGGCTGACCGACTCGTCGACGGCGCCTGCTGTCGGGGATGCTGACCCCACGGTGACAGTGGAG
ACCGTGACGCTGTTCGCTCAGCTGCAGAAGAGCTCGTTCCGGCTATCCGACGTGTCACCTCCTACCCAGGCGATGCACCCCATGGTGTCGTTCCAGGCCC
GTGACCGCCACTATTTCATTCACCCGGAGGCCTTCGAGGACCAGAACCTACTGAACAAGCTCGTTGGAGCTGGAAAGCGCAAGTGAAACTAGAGGTGCGA
GCGATCTCAACCTGTGCAGGGCGAAAACGCGATATAGAGCTATCGAGTTAAGAGGGTGCTTTCAGCTTGATACCTACGCTGTTATTGCTTGTGAATTTCT
TACGACGATGATACCATTCCACGGGCGCGTTATTACCACCCACCTCTCTCAACATCTTCAATGTAGTCGTAGCTGTTCAACGCATCTTCACTGTCAACCC
GGGTATCGTTTCGAAGGGTGCTAGGTGGCTCGATCTCTGCCGCCGACGTGGCTGCTCCGTCTTCGCTTTCATCTTCTTTATCCGAGAGCTCTGGCATGGA
CTCCATTTCCTCGGAAATCTCGCTGTAGGGACCAAACAGCATAGAAAACCATGAACGCCATGAAGCATACTTGGAACAGTACTCGTGGTTGCTCCTTACC
TGGCAATTTCTTCCTCTTCTTCGAAGTCGCTGCTTCCATATCCATCGTCATCTTCATCATCATCTTCGCTCTTATTACCTTGAGGCTCAGCGTCTGCGTC
ATCGTTATCCTCATCCGCTTTGCCGGGGCCCCCACTACTCACCAAACTATCCTGCTCTTGGAGCTCCATTTGCAGCGACTTTTTCAATTGCTGGAGAGTG
CCTGTGTCGTCTTCCGCCTCCATGGCTTGCAACGCTGCATCTAGCTTCCTCAACCGTTCGGCCTCCTCTTCCTACACAAGGCAAAACAATAACTATTAGG
CCACAATAAAACCCGTGAATATCTCAACCGCTCTTACCGCATCGAAATCGTCCTCTGCATCTCCAGCATTGGCTCCATTTGATGTATTCATTAGAGGTGG
CAAAGAAGGTAGCTTTGCGGGTGCTGGAGGAGGAGCTGCTAGTGACACGGCATCGTCGTCGTTACTTTCGTGGGTATCCTTGTCATGACTCTCTTCTTGG
TCCTTGTCACCCTGAAACTTCTCTTGCTGGTGTGCCGAGTAGAGATCAGTGGGTTGTGTGCTAGCTTGGGCACGGTAGTCTTGGCTTTCTTCATCCTCGT
AGTTTGTAAAGTTCGACTCCTCCAGTTCAGATCCACTTGGTACCTCTTCCGCCATGCTCTCTTCGATCTCTGCGCTGCTCTCAACCTCTTCCTCTTTGCC
TTCATCTGTATCTTCATCTTTACGCTGCATCAGGGCTGGTTCGGGCTCTTTTACAGGTAGTGAGTGCGTATCGTCGTCTCGCTCCCATGGCCGCGCCTTC
CGTGCTACGTCGCCTGCATGCACAGTGGCTTCTTCACCACTTTCTTCGCCATCATTGAATTGATCGGGCTTGATGGTCGTCGCTGGCCTGATAAACCGAT
CACTCTGATCGTTGCCTAGCACCCTGGACTCGACGAGCTGAAACAGTGTCGGCATGGCCGACGAGTTGGTACTTCCTAACCCGAGCTTCTTAACCAGCTG
TGCACTATCGTAAGGTTCATCTTCTGCATTGGTCTCTGCGAGCAGAACACATAACGCGTGCTCCCAGTGGAAAAACTGCAGACACTCGACAATCAGAGCC
AACGCAGTTGTCCTGGTCTCCAAGGGGAAGTCGCTCAAGTTTGGGGCCGTAGGGTCATTCGTTTTCGCGAAACCCTCTCGCTCGTGCATAACCTCAAAAA
CTGCAGCACGTAGCTCTGCCTTCAACTTTGCTAGAACGCCCTGGCTTGTTAGCACCTGAGTAACCTGTTCCTTGAGCGCCAGCTCCTCCGCCGTTGGTGC
AGGCTGCAGCAATGTCGGCAAGACAGACATCATGAGGGCGCTCCTTCCGACACGAACCGGCAAATCGCAAAAGTGCAAACGGCCACCGCTGAAGGCGTCT
GTAGCGACCGAAACGGTCAACACAACGATAAAAATGCCGATACATGCTGACATTCCGCAACCTGGAAGCAGTCCATCTTGTTGATACGTTTATCTGTTCG
TTGAGACAACGCACCTGGGTGTCCGGCGCACAGCTTCCTTGACATCACTTTTCACGCCGCGATGGTCGCCGTGAAGCGCGTCATGATCTGGCTGCGACAA
GAGCATCCCCATCCGCACAAATGTCGTCGTATAGGCGCTCAAAACCTTGGGGCGTGAACGGGGTGAAGCCCGCGGCGTATGTCCAAAGGCATGTGCAAAG
CTCGTCAACCTCGCGAGACGACGCGTTAGGATGGTGCCGCTCCTCCTTGTCTTGGTGCTGTGTCACGATGCGATCGATCTCTTCCCCGATGGTACTCACA
TACTTGAAGACCTTCTCAACGACAGTCTCGTCCTTTTGGTTTCGAGACCAGTCGGCCATTATCTTCATCTTTTTCAGCA