Description :
From Genome Similarity Track
Location :
Scaffold_65:316030- 324171
Sequence
8141 bases(100 bases per row)
TGAGGATCGTTGACCTAAAGCCACACGTCATTCACGCAACAATCATGACGGGGGAGCGGCGGGGTCAGCATGTTCTAATTCCGCGGATTATTTTTGTCAG
CGACGATGATACTCGAGAGTTTCCGTTTCGTCTACGTCGAAAGCAGTTCCCTGTACAGCCAGCGTTTGCAATGACTATCAACAAGGCCCAAGGTCAAACC
CTTATGAATCTAGGGCTATATCTTGCTACACCGTGTTTCTCACATGGCCAGCTGTACGTCGCCCTATCAAGGGTTACATCACGCTCGAATTTTCGAGCCC
TCATTGAATATCCGGAACAGGAGAAGGAAAATGGAGTCTACACAAGCAATATCGTTTTCCGACAATTTTTTGACATGTAAGCACATTTTTTTTACATTTT
ACTTCGTTACATCATTAAAAAAAATAATTTAAAAAGAGAAACATGAGGCACCGGATTGAGAGCGAATTATAAAGTATCGCTGCTATTTTCGATTTAGAAA
TCATTGTTTGTCCCACCCCTACTCCCCACCCCGCCGGAGCGAAGCGGAGGCGGAAAAAAAAAAAGGTGATTTAACAAAAACTACCGCCGCGTAGCGGCGG
CGCTCGGCTAGTCTTAAACATCTACTGCAGCAACCTGTCTGTCCGTCACACTAAATTGTCGTGCCTGTCACGCTTTTCCGGACAGTTCATTGGACAAAAT
TAATGAAAATAACATACATGATTGGTAAATAAACTGGATTTAATGACGATTGCTCAACCATGAAACAGCCAGTTTTTATAAATCTGAATTCGTTTATTTG
CCACTAGATTTTTCTCAGCAGCACCGCAATTTTTTTTTTGCGAGCCCACAATTTATTAACCGCACACAAACACATTATTGCGAGTACATGTTAAATGCAT
TTCGAATAGACAGCTGTGCGAGTCTATCCGCCGTTTCTTGGACGACCATGCTTATTACCAGCACGATTACCGACAGAGAGCATTATCGTCGCTTTGCATT
TTTAGGTACGCAACAGCTGGAGATTACAAACGGACCACCATATCGTATGTCAACGTAAATCAGGCACTTACACATATAGGTTTTATTAAAGGTCAAACCC
AATTTATTAATTTAAAACTCTCATTATTCAATTACCTTTATGGTTCTTCGCCGCACACGTGATTTCGAATTGCAACAGCTACCTCGACGTACGTCCGGTC
CAACGTCCTCGGTACAGCTATCACAAAGAAATTGCAGACCTTCGCGCTACGCTGGACCGCGCTCGACATACGATTGCGTATCTTCGCTCTAGAGTTAACG
CTCTCGAGCTGTTCGATTCGGACAGTGAGGACTACGAAGACAGCGATACCGACGACGACGATGAGCCTGAACCATGGTTCATCGACGATTATGCCGAACC
CAAAAGAAACGGTGACGAGTGTGTCATAGATTTAACTTCTGATACCGGATAATTCGGTCTAATCTTTGCCCTTTTCCTCTTAAATGAAATAAATCTTTGC
CCTTTTCCTCTTAAATGATATAAATTAGCTTTGCTCTCATCTTACTGTCTACTTTATTAATTAATTACTTATTTATTTATCTTTATTAATTTATTAAAGA
ATCGAGCGGGTTCCTTTCTTAGCGGCCGGATTCTTCAAGATATCGAAACACTTGCGCATACGCCGGTGTGTCACGTTTAACGTTAGGGGGCTGCAATGGT
CATGTGAGTTCTCAGTGTCGACTCCCAGGTCTAATTTTGCCTTCGACCCCACGGTCAGCCAAGAGGAATGGAGAGCTTTGGAAGCGAGGTACGCTACGCC
GCCGGCCGTAGAGGATCGTCCGGTCTGCGTACGCAGAGCCGCCAATAGGAGGCAAGCGCGGAGTCGGCTAAATCGCCGCCAAGTCGCCCGTGCGCTTCAA
GCTGCCGCTGATTCGGCTGCGGACGTATCTGTTACTCAAGCTGAGCGAGCTGTGCTGGGTCGCCGGTACGCTTCGCCCCTACATTCGGAGGAGAGCCCTG
TCAGGCGTCACCGCTTGCAGAACCGCTCTCGGGCTGAGCGTCGCGTCGACGTTGCTGCTGCACATCGAAGGGAACGGCTAAACATCATTAATGTGAACCG
GGAAGCTCTTCTCCTCGAGGCTCCTGATCCGTTCGATACTGAAATTGGCCGTCTAACAATCGAGCCACTTCAGCTGCACAACAATGCTGCTAATACCACC
GTAGATGTAGGGCCGTCTGAAACTCTACACATCCCCCAACCGGCAGGTGGTACCGGACGGGTCAGGCGACGTCGAACAAGGGCTGAGATTGAGGAATCTA
TGCGCGTAAATGAGCATGTAAACAGGGCGCCAAACGGTGTGGAAGATTCGGAGTCTAAGCGCCGGCGTTTGGCGAGACTGAACCAACAGCGACTTCGACT
CAACAAGGCCTTGGCGGATCTGCGTACGCACGAAGCTGAGGGACAGACTGGCTCACTTGCTGCGGTCGCTGTACAGAGAGTTACAAATACCGAGCGGCAG
CGCACGCATCGTGCCAGCCTTTCAGATGAAGCTCGAGCAGCGGCAAGGGAACATAATTCAGAACTCCGTCGGGAAATCCGCGAGCACATTACGCAAGACG
AAGCAGGTCATCTCCATGAAATCGATCGTCAACGTCACGCTGATACCCGTTCGGCTCAAGCCATTGAAGTGCAAGAGGCGGCGAAGGAGGCGGCACGAAT
ACGACGGAAATGTGTGCGCAGGGGGCATGCATTTTGTAACCACGACGTATTCGATAAATCTCGGGTCTCAGGGAAGAACGTTTCAGATGGCCGACATCGG
CTTCCTGGGATCTATCCGTGTGGTTGATGTGGACCCTGGAAATGGCCAGGTGAATCTCAAATGTCGTGTTGCCTTGCAGGCAGAGTACGACTACGGGCTT
TGAAGCGAGTGCCTCCTGTGCTTCTACAGTACTATGGGGATCGCGAGTTCAGGAAGTATATTCGGGCGTACAATCAAGTTTTTGCTTTTACCTCTATCGG
GGTTACTCGCAGTGATTGCCGTGGGGTTCAAGGCGTTAGAGAAGATACTTCGGTGCAAGGACAGCGAGGGGTGTACATCTACAGAGTCCAAGGGGCTATG
TGCCATTACTTGGGTTCTCTGTTACCTCGCATGGACCACAGATCCGGTCAGTTTTTCCTGCTAAATTTGCGCAGATCTACATCGTATATGATGATTTAAG
GCAAAGAACGTTGCGACGAAAGGGTATTTTTGCGGAGCTCGACCATGAGAAGCTGACGACTCTAGAGCTAATGATGGCTACGTACAACCCATTTGCCAAG
CAATACCTCAACCACGGAGAGAAAATCCGAAGAGATATGGCAGAGGGAAACGACTACATCAACGTTGTGTACCATCTACATGCTGACAAGCGCAGACCGG
GGACTACCAATCTACCTACTGTGAGCGAGGTTGGTGCCGTAATGGTCAAGGATGCAAACTTTAACAAGTATCGGGATCTACAGCTGTACACCAAGCCGCA
CGGACTCTTGCGTATTTTCGAGACCAACCCAATGTATGATCCGCTACAGTATCCCTTGCTATTCCCGATGGGAGAGCACGGTTGGACATTTACTGATACC
TACGCCAACGGACAAAAGTATCGAGATAAAACAAAGATGTCTCTGCGAGAGTTTGTTGCGTATCGACTATTTCCAAAAGATGACGATGGGACCGCTTTAC
ACCACGGTGGTCGGCTCTTCCAGCAGTGGTGTGTCGACCAACGAGCGAAAGTGGAGCAGGATTTTTTGCGGTGGGTTTCCAATAACCAACAGACACTACG
GGCGGAGCTTTACACCGGCGTAGCAGACGCATATCTGGATGAGACTACCTTGGTTTTAGGTGAGGGCGAGGGTCTAATTTCCGAGTACAATCGAGAAACT
CGCCGTTTACAACCCCCAAGGTCTACTCGCACTACAGAACAGCATTTCTTAGAGCGCGTTGGCAAGAAAATCATTTTCCAGCGACATCACTGGTGGGCCC
AGGCAGATGTACAAGTCTTATCAGGACTCAATGGCGATTGTTCGCGAATACGGAAAACCGGATATTTTTTAACGAGGACGTGCAATCCGGAATGGGAGGA
AATTGTCAGCGGTATTCCTGGCGGCTATACCGCACAGGACCGTCCTGATTTAGTAGCCCGGGTTTGGCAGCTAAAACTCCGCGCCCTGTTGAAGGATTTA
GGCGAGGGAGTACTTGGTCGCGTCCAAGCTCGCATTTACGCTGTTGAATTCCAAAAGCGAGGCCTCCCTCACGCGCATATCTTGATCATTTTGGCGGACG
AAGACAAACCACGGACACGAGATATCATCGACAAAATGGTCTCTGAAGAGATTCCCGACGAAGTCAGCAACCCAGATCTTTATAAGACAGTGATGACGTG
CATGATGCATGGTCCATGTGGACACTTAAAATCCCAGTGCGCCTGTATGAAGGACGGCAAGTGCTCCAAAGGATTTCCAAAACCTTTGGCGGAGATTACA
CGAGCAAATGTTGATGGGTATCCGGTCTACAGGCGTCGCCGTCGGTCGGAGGGTGTGTTAAATTTGCGAGGTCGGGAGTATGACAACGCGACGGCAAACC
AATGGGTTGTACCTTACAATCCGTACTTCTCGCAGAAGTACAACTGTCATATCAGCGTGGAGATTTGTACGGCTATCACGGCTGTGAAGTATCTATACAA
ATATGTGTACAAGGGTTCCGATAAGGCAGTACTCACGGTTGAAGCCGTGAGGGGGGATGGTGAGCAGATGGGCAGACCACGCGACGAGCCAAATGAGGTG
TTGCGGTATCTCAATGCACGGTACATATCTCCTGTTGAAGCTTGCATGCGGCTTCTTGACTTTACCGTTCAAGGAAAGAGTCATTCCGTCGAGCAGCTCA
CAGTGCATCTGGAACAGAGGCAGATGATTGCCTTTCGGACTAGCGACCGACCTGAGACCGTTCTCGCGAATGGCGAGCACACGATGCTTACTCGCTTCTT
CGATTTGTGTGCCAGCGAGGCCCCGGAAAATCAAATCGCAAAAACAATGCTTTACCAGGAGGTACCGAAAAAATTCAGTTGGAAGGATAAGCAATGGACC
CGTCGTACCAAATTTCAAGCATCGCTCGGAAGACTGATTCACGTGTCGATACGGGATGCTGAGCGGTTTTTTCTTCGCGTGATGCTGTATCATCGCAGAG
GTCCAACTTCATTCGAAGATTTAAGGACGGTAGGTGGCGTTGTTCACCCGAACTATGAGACGGCTGCCCTGCATGCCGGCTACCTTCAAAACGACGAAGA
GTGGGTTGCGTGTATGACCGAGGCTGCCGCATATCAAAAGCCCTACCAGCTTCGCCAGTTGTTTGCTACGCTTTTGGTGTACTCAATGCCTACCGATGTT
CGCGGTTTGTGGAATACGTTCTACAAGTATTTGTCTGAGGACTTTCTACACAGATACCGCAACCTGCTCGATCCAGTTCGGGGTTCCGTTGTTATGTTCG
AGACGCTGAAAAGTATTAACGACCTTTTGCGAGTTAGCGGGTACTCCGTCCAGGATTTTGATCTACCTCAACTCAGCGATCATCCAAGATTAGTACTCCA
GTCTCTTCAGGAAAACTCACTTATTCGCCGCGAGTTAACAGGATACGACCGGGCTACGTTGGAGGAAATTGTGCGCGCTGGTAGTCGACTCAATGCTGGG
CAACAAGCAATCTATGGCCAAATCACTGCCGCAGTAAGCGATCCGGCGATTGGCAAAAAGCTGTTCTTCATTGACGGACCTGGGGGAACAGGAAAAGCTA
CCTTACTTCGACACATACTGGCAAGGGTGCGGCTCGACGGCAAAATTGCTCTAGCAGTTGCGTCCAGCGGGATCGCGTCACTACTTCTTATGGGCGGGAG
GACAGCACATTCCACCTTCAAGATACCACTGAAGTTAGACAAGGACTCGACTTGCTCTATTTCCAAACGATCACATTTGCGAAAACTGATCGAGAAGGCG
AGCTTAATTATCTGGGATGAAGCACCGATGACCCATCGGCATGCATTTGAAGCCGTGGATCGGACGCTACGAGACATCCTGAGCAACCCCCGCGAGCCTT
TTGGGGGTAAGGTGTTTGTTCTTTCTGGAAAATTCCGGCAAATTCTTCCGGTTGTAAAGAGAGGCACGCCTGCGGAAACAATTGATGCCTGTCTCAAGTC
ATCCGACCTTTGGCCTCATTTCCAACAAGTGCGGCTTTGGGAGAACATGCGCGTCCAAACAGCGGATAACCTGACAAGCGCTGACGATATTGCTCCATTT
TCAGAGTTCTTGCTAAGGGTCGGCGAAGGGAGACACGAAATCGACCGGGTCCTGGGCGGAGAGTTCTTGAAACTACTTTGTGATATGCTACTGGATAACC
CTCCGGACGAGCCAGATGAAGATGCTGACATTGCGCCTGGTACAATTCCAAAAGGAATGGCCAGAATGATTGATTTCATGTATGCTGATGTGAGCGATCC
TGATGTCGCTACAGACGAGTACTTCGCCAACCGTACAATCTTGACGACGACTAACGCATTGGTCCACCGCATCAACGAGGCGGTTTCGGGTCGACTTCAA
ACGACCGCGCATGAATACCTATCTGCTGACTCCGTCAAAGACGATGACGGAAGTGTCTTCGAACAAGAGTTTCTTCATTCCGTCAACATTAACGGAATCC
CGCCCCACAGGCTCATACTCAAGAAAGGCATTCCCGTCATGATGATGCGAAATCTGAACCCGGATTTGGGGCTCTGTAACAATACGCGCCTGAGGATCGT
TGACCTAAAGCCACACGTCATTCACGCAACAATCATGACGGGGGAGCGGCGGGGTCAGCATGTTCTAATTCCGCGGATTATTTTTGTCAGCGACGATGAT
ACTCGAGAGTTTCCGTTTCGTCTACGTCGAAAGCAGTTCCCTGTACAGCCAGCGTTTGCAATGACTATCAACAAGGCCCAAGGTCAAACCCTTATGAATC
TAGGGCTATATCTTGCTACACCGTGTTTCTCACATGGCCAGCTGTACGTCGCCCTATCAAGGGCTACATCACGCTCGAAATTTCGAGCCCTCATTGAATA
TCCGGAACAGGAGGAGGAAGATGGAGTCTACACAAGCAATATCGTTTTCCGACAAATTTTTGACATGTAAGCACATTTTTTTTACATTTTACTTCGTTAC
ATCATTAAAAAAAATTTATTTAAAAAGTAAAACATGAGGCACCGGATTGAGAGCGAATTATAAAGTATCGCTGCTATTTTCGATTTAGAAATCATTGTTT
GTCCCACCCCTACTCCCCACCCCGCCGGAGCGAAGCGGAGGCGGAAAAAAAAGAAGGTGATTTAACAAAAACTACCGCCGCGTAGCGGCGGCGCTCGGCT
AGTACTCTAAACAGGGGGGGCAACTTGCACGGTCAGACTCAGTGACATTATGCTAGCGGATCCGACAATTGTTGCTGCTCGTGATGATATCTCCTTATAC
ATTGTCACAGACACGATTCACACGCGACAGCAGTCTTCGGCACGACTTTACCTACGGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAAGATCTGA
ATGTTGGTGTCTGGGTATTAGATGTGGTGGAACAATAATGAAGGGCTGTCAGCGTACAACAGAGCGAGCATTGAGTGTGGCTACGGACAGGCTGGTCACG
CAAAGTGCACAATAGCAAACTAGCAAACTAGCAAGCTAGTAAGCTGAAGGCATCGGTAAGGAAGTAGTGAGGCAGGAGAGGCAAAAGAAGAGCCCCCAGG
CGGGATCGAACCACCGACCTTTCGCTTACGAAGCGAGTGCTCTACCACTGAGCTATAGGGGCTTACGGACCTCGACTCAAAGAGACACATTCACAGCACG
AGCACCACATACACCACAATAAAAACATACGCACGAACATGCATACATCGCACTCACCGTCCATGCATACACCATACGTCAACTACTACATCACCGCCCA
CTCAGCGCATGCCACATTGCCACATCAACTCCTTTCCTTAAAGCTGCTGCGACGCATCGGTAAGGGCTCCGCCACTTCAAACGACGCTTCGATGAGCGGA
GAGATGTGTACGAGGTGCTCGTGACGTGGTTTCGTCGTAGA