Description :
From Genome Similarity Track
Location :
scaffold_158:316- 2081
Sequence
1765 bases(100 bases per row)
CATTCGATCAGATCAAGGACGATGTGATGGAAGCACCATTACTTGCTTTACCAGATGATACGAATCTGTATAGTGTGTTGTGTGACGcttttgagtttgc
aatcgtTGTGCTGGACTcagaaagacgcgatcgtgTAGTTCCAACATAATTTCGACAGCTGAAGCCAGCAAAAAACAACTACCCTGTTCACGACAAGATG
ATTTtaacaatgaagtatgctctgGTGAAGTTCCGTGTTCACCTCTTGGGTTCAACTCCAATTGTCGTCTACACGAAGAACGCTATCTTGCGATATGTAT
TTCAGTCTCCTCATTTGTCACAGCGTATGGCTCGCTGGTTGTCATTTTTTGCATAATACAACTTCACGGTTGCGTATAAAGCGGGCAAACTAAACGTGCC
GGCTGACGCATCGTCACGTCGTCCGaattatgagctagctcgTATAAGCTATATCAAAAACGATGTATTGGATATGAAACGACGATCGAATGTCGGGGAT
GAACAgtgtgatctgatcatcaaCGCGCTCTCATCGATTGATATTAAACTCTATGACAAGCGTCCTGATCGCTTGAAATCACGGATGCATTGTTATACAT
CAACAGGATGGTCTCCTTTACTATCAAGTTGCACATGACGACAAGCCACGATAATTTAAAGCACGACGTTGTGTACGAGCGACGGCGCTCGTCGGCGGAT
CACTTGTCCGTATGAAGAACTATGAGTCTCCTAGTGCTCAACTTTGGTGGTAATGGGTGACATGATACGTGAACACATGCGATGTCTGTCTGCGCGTGGA
TAGCGCACGGCACCACTGCAGATACTCCCTGTTAATACTGACTGTAAGTCAGTCGGTCTCGACTTTATCTTCGGGTTCTTTGAGAATGCTGGTGGTCACA
ATGAAGTAATCGTCACTGTCGACaaatcagcaagatggttcgcaTCGCTCCATTTATAGCGATTCCATCGATACCGAAGGTTCGGCTAGATTATTCAATG
CTCTCGTTTCTGTAATCACGGGTTGCCAAACGCCATACTCTCTGACCGTGATACACGATTCACGAGTGTCTTTTGGAAAGACTCATTTTGAATTGATCCT
GGCACTCGCTTGGATATGCCCACGATGGTATACCCGGAGACCGATGGGCAAACAGAACGTTCCAACCGAGTGGTCGGTGATGTGTTGAGAAGCTTCTGTT
TGACAATGCCGCAGAACGGATTTTGTTGTTACTATTGGTAAAGTTTGCTACGAGCAATTCGGTTCACTCGTTCACTGAGCTTACGCCAATTCATATGAAT
GGCTTGCGCACCCGCAGTTCccgctttgtgcgatggtTAGTGTCTCTGATTTGAGTGGGGGATGATTTCACCAAATCGTTGCCTctcaaattgatacaat
caatTATGCGATTACGAATTACAAGTACAAGGACGCCCTGGACCATTTATCATGAGTCGAGTGAATGTTATCACATGGGTGTGCAATGACGAACACGCAA
GATCTACAAAATGATAACGCAGATAGATGAGGTTTTATggaaaatatatttaatttttGGAGATGATGTACTATTACGTACTAAGAACCTATCAGACGAT
GCGGTCTCAAACTTGATAGTCTCGGAACTACTCCCTCAATTTATCGGGCGATTCCAAGTTGTGCCATGCCATGCTTTATCGATCTGCCAAGCTGACCAAA
ACCACATGCAACGTTCTACGCAGGGCACATCAAGTCCTATCATCGCGATGACGCGACTTCCGACC