Description :
From Genome Similarity Track
Location :
scaffold_69:31598- 33214
Transcript NameFunction/comments
Pl_110539Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1616 bases(100 bases per row)
GCCACATTGTCAACCATGGAGGTCAAACCCACCTTCATGCAAAATATTTTGCGAACCAAGCCGCTGGCGGTCATCAAAGCCGAAGAAGCTGCCGAGGAAC
TACCCCGACAGCTATCTCTCTTCGACTTAGTGTGCATTGGCGTGGGTGGCACCGTCGGTAGTGGTGTCTTCTCCACGACGGGAGAGATCATCAGCGGCAC
AGCAGGTCCGGCAGCTTTTATCAGCTGGATCATCGCAGGTGTCGTGTGCTGTATCAATGCTCTAGCCTACATGGAGCTGGTGACTCGAGTTCCATCCTCG
GGTAGTACCTATGCCTACTCGTTCTACGCACTTGGAGAACTGCCCGCTGTGATCGCAGCCTGGTTGCTGACACTCGAATATGGTATCTCGGGATCTGGCG
TGGCCCGGAGTTGGGCCACCAAAGTCCAGGATTGGCTCGTGGAGGAGCACCCAGAACACACGTACCAGTGGTTGAACGAAGACTACACAAACCTGCTCGG
TGCCGTTCTCATGGCGCTATGTGTAGGCGTGCTTTTGATGGGAGTCCGCTTCGGCAAATTGTTCGTGAATACCATCACTTCGATAAAGGTTGGTGTAGTA
CTGTTCATCATTATCGCCGGTTTCGCCTTCATGGATCCAGACAACCTCTCCCCTTTCGTCCCGCCTCGCCAGGACCTGGACGGCACGATGGCATTCGGTA
CGCAGGGTATCATCTCCGGTGCGTCGTCGGCCTTCTTCGGCTACATTGGTTTCGATGAGGTTTGCTGTCTCGCAGCTGAGGCCAAGAACCCCAAAAAGAT
CATGCCTCTGGCTGTGATCACTGTAGTGCTCGGCACGATGTTTTTATCTTGCTTCGCGTCGCTCGTGCTGTCGGGCATGATTCCGTACCTGCAAGCTGAT
AGTTTTGGCGCTGGGTTCGAGTACCAAGGTGCAGATTGGGCTGCTCAGATTGTGCGTGCAGGTGAGACTTGCACGATGCCAGTTGTCGTGTTGGTAAGTT
TCCTGGCACAACCACGTCTGAACTACGCTTTGTCGTGCGATGGCTTGATGCCACGCATCTTTGCTAAAGTTGACGATAAGGGTAACTTATTCGCGAACAC
CCTGATATCGGGTAGTTTCTTCACGGTGGTGGCATTCGTAGTGCCGTTTGACACTCTGTGGGATATCGTCAGCTTTGGCATTCTTCTGTCGTTCAACATG
TCGATGTCGTCCCTGCTCATGGTTCGCATGCGAAAGGAATCACCATCGCTCGCACCAAAACTCATCGGTCTCTTGGTGGCATTTGCGTGGCTCGCAGCTT
TCTTCTATCAGATCGGCTACTCGAACGAAGGCCACACTTGGTGCCTCGTGCTGGGTATTATTTTCCTCGTACTTACGGTCATCGTGTGCTTCGTGATGTA
CTTCAAGTGCCCTCAAGAGGCACAGAGTGGTGAAAACTTTACTGCTCCGCTTGTGCCGTTCCTCCCCACCGTTGCCGTACTGGCCAATTTCTACCTGGCC
GCTCAGATTAGCTACACGGGCATCTACACGAGTTGCGCATGGCTTGCGGCTAGTGTCATTTTCTACTTCTGCTACGGCTACAAGCACTCAGCCGGTCGCA
CGGGTTGGAGCGCGCT