Description :
From Genome Similarity Track
Location :
Scaffold_52:31586- 36497
Sequence
4911 bases(100 bases per row)
GAAGTGGAAGACACCATTAAGGCTCGTCACATCGTCGATGAAGAAATGCAAGTTGCATTCGCCAAATCAAATTTGTCAGGGCGTGCCAGAACTTGGGCCC
GAAATCTTCAATTGCACGATCCAAACGTGTTTGGGTCGTTGGCGGTCTTTAAGACTATTTTCAGCCAAACGTTTGAACCGCCAAGAGCTGAGTTCAGGAC
TCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCTTGACGTTCACACTTACGCTCAGCACGTTCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTA
AGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAAACACCTATTCCGTATCGAGTTAAAGTCGCTTAAGGAAGCGG
TTAAAACTGCGGTGAAAGAGGACTTTAGTGTGAGACAGACTCACATTAACTTGACCCCCTATCGTCCTTCGAGACGAGTAAAGGCGGGAGGTTCAGAACC
AATGGACCTCTGCAGTGTGGATAGAGAGAGACCTTGATCTTCAAGCAGTAAGCAATTTCAAAAGTGCAATCTCTGTGAGAAGTTAGGACACTACGCCTAT
GAGTGTAGTGGTTCATGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGTCTGCCAAGAAGGGCAATGGACGCGGGTCCGACGCTATTGCGAAGT
CAGAACAGCAAGGCGGACCGTAAAAAGCCGTCGGGTCAGTAGGGGCGGGGCGCCCTACTGATCCAGCAACCTCAATAGAATTTGAAAACCTAGTGCTCCG
GACTCACAATCACTGTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCACCTTGAATTTGTAGGTGACAGAAGATTTGTCACTTCGTGCCTTAGTTG
ATTGTGGGGCGTCGAACAACTTTGTTCGTCGCCATTCGCTAGAGGATCGTAGGCTCAAGTTCGCTGAGCGCGTTACTCCCCCTACGAGGCTGACGGTGCG
TTTCGCAACAAGCGCATCAATAGCAGTGATGAAACGTGTAGTGGGATTTCACTACACGTTACAAGATTTGCAGTACAATGATGATTTCATCGTACTTGAT
TTGGATGACAAATTTGATGTCATCCTAGGGTTACCCTGGCTCAGAAGGTACGATCCAAGCGTCAGATGGAAGCATCGAACCGTGAAGATGTCTGCCACTT
GTTCATCATATGACCATTGGATGAACGTCTTGGAGCGTCCCCAAGCGTGTGGATGTACTACAAGTGAGTGCGATGGCCTCACTTGCGGTACAGTCGTTAG
TACGACTGCACAAGATCCCAGTGTGTACAGCCAATCACACTGTGGAGGAAGCGGCCAGCGGCTGTGCAGATGCACATGCAGTGCTGAAGGTCCACCACTC
GAACAAGTCCAGTGGATCGGGACATGGGTGTACGCCTATCGGGCGACATCCAAGAAAGAATAAACCAGTTGACAACACATGGCAGCACGATGATCCTAGA
TCGACTGGAGAGTCGATCGTAGAGGATCTAGCTGTGGTAGCGCAAACCACAGCTAGAAGACATCGAGGGAATAATCCCCAGCAGCCTGTGGAAAATGGTT
CCCAGGAAAAAACCGAGACGTAGAATGTCTTGGTTAATGACGGGTCAAGTTGGGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAATTGACTTCGGA
GATCACTCAATTGCCAGCGCTAGAATCGAAACGGTTCTTGTGAGATCTGAGCAGTGGCAAGGCCAAGCCGATCTGTGTAATCGTCACAGAGGACGATTAC
GTGACTGACATTCGGTCGGCAGTAGTATTTGCCGAGAACGAATGGGTTCTCAGCAGCTCATCAATGGACGAAAGTAACCTCGATGAGAAGACTCGTATTG
AGCGATACACGTCTCAATCTTTGGAGTCGCTTCAGACAAATCCTTTATATAAGAGTTTTTGAATACAAGGACGTGTTCCCTGAATCCGTACAATGCGAAT
TGCCTTAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCAGGCTCGAAGTACTGTGTCATGAAGTAGTGGTCACTGCCTCGTGAACAAGTAATTGC
GATCGACAAGTTATTTACAGATCGCTTAGCAGCCGGTCATGTGAAGAAGTCAACTTCCCCTCACAGCTCTCCGACCTTCTGTGCGCAAGGCCACAGGGAG
ATGGCGGATAGCGCACGCATTCAACAAGTTGAATGCTGCAACGGTACTGTCTCTGACGACAATAACGAGGAAGGACGTAATCATTGATGGTATGTCCAAG
AGTACCTTCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGCA
TGCTCTGGGAGTGGCTAGTAATGCTACAAGGGCTTAGTAATGACCCTGCCACCTTCAACAGATGTGTCACAAATCTGTTGAGACCGGTGCGAGACTTCGC
ACCGAGTTACTTCGACGATGTATTCTTCCATAGCTGGGCTATGGGCGGAGAGACGGACGTAGCGGTTCATAGAACTCACGTTCGTTAGGTTCTTACACTT
ATGCGGAAGCATAAGCTGTACGCCAACCTCAAGAACTGTATATTCGCTGCTAGCTAATTACCACTTCCTGGGTGCATCTTGGGTAAACACGGCGTACGCC
CTGATCCTGAAAAGATCAAGGTGATTACCGACTGGCCTGTGACAGTCGACGTCAAGGAACTAAGAAAGTTCCATGGTCTAGCGGCGTACTTACATAAGTA
CTCGCGCAACTGCGCCGAGATGACCGTTCACCTCTCTCGTCTCTTGAAAAAGAGCAAGAAATGGTCATGGAACACTGATTTTCAGCTTTCCTTTGAAGGT
ATCAAGCGGAGATCGATGCAACTGCCCATCTTGGTCATTGCAGACCAAGGCAGACCATTTCATGTGGTCTGTGACGCCAGCGATCTCGCAATCGGCTGCG
CGTTAATGCAGTACGATGCAGAGTGTGTCATCTGTTATCAATCGCGTCAGCTGCAAGCAGCTGAACGCAACTACCCCGTCCATGACAGGAACGCCTTGCC
GTGTTGGTGATATTCAGAGTCTATCTACTAGGCGATAGACCCTTCATCGTTTATACGGACCATGCGTCTTTACGCACGACCGTAAACATCCACACCTCTC
GCAGCAGATGACGAGGTAGCTGTCATTCTTTGCGGAGTATAACTTCTGCGCCGAGCATAAGCCAGGACGACTTAACGTCGTCGCTGAGGCACTCTCGCGC
CGGCTCGATTTTGAGCCGGCTGCGCCACCCGACACTGTTCCGACCACTGTCGCGGTACTGACTTCGAGTGTCGTCAACCTTATTGGAAGACATACGAAAG
GCGTATGATCCGGGAATGGTTTGATTGCTGCATCATCTCTCGCAACCATCTCGGAAAAGCCTCAAACGGTTGTCGTCAGTATATCGATTCTCTACGGATT
GATATACAGTTCGCAACGGCTTACTCCAATATTTGGCTAATGCAGGCGACACGCCTCGTGTCGTCGTACCAGATCATGGTGATTCGCAATTGCGTATCAT
GTATGAGTACCACGACTCACCTGTTAGTGGACATCGTGGTCGTGAGAAAACATATCTCACAGTGAGCCGCGACTTTTACTGGCCCCACCATTATCTGTTC
GTGTGCAAGTACGTTCGGGCCTGAGAGGTCTGTCAGCGGGTGAAATCTAGTCCTTCCCTTCAGCTCCATTACAGCCTCTTCCCGTCCCGGCAGAGTGCTG
GGAATTTGTCTCAATGGACTTTGTATTCGGATTCCCCGCAAACTCTCACAAGAATCCTGGTATTCTTGTGTTTGTTGACAGGTTCAGCAAGATGTTATAT
CTGGTTGCTGTACCCGAATCAATAACGCTTCGGCTTGGGCCCGTGTCTTTATCGACACGGTCTTTCGCCTTCATGGGTTGCCTCGGGAACTCGTGTCCGA
TCGGGACCCGCCGTTCACAGCTTAGTTCTGGCGCTCCGTGTTCAAAACACTTGGATCGCGCTTGAAGATGTCCACGTCTGACCATCCTGAAACATATGGT
CAGACCGAACGCGCCGATCATGTCCTCTAGGAGATCCTTCAAGGATACGTCCATTCCTTTACGAATTGGAGCGAATTCCTGCCGATGGTGGAGTTCGCCA
TCAACAATTCAGTCCATGCGTCGACGAAGCACACGCCGTTCTTCGTGAATGACTTACGCCATCCGCGTCTTTCCACCTTTTTAGAGTGTGACTCTCGTTT
AAGGGGGGAGGGACTCAGTCGAGCAACCGTCAATCCGGCCCTCACTCGTCACGTGCTGACAATGCGGTCACCACGTTCGACGCCGATGTCGATCACATCG
GCTTTGGTGAAGAAGACGGAAGTTAGAGTAAAGATGCTCTTACTGGCCACGATACTGATCAAATCAGTATCACGCCTAGTGCGTCCAAAGACACACTCAC
AGAGGTGACAAGTGATCTTGCTGCAGTCCGCTCCAAGATCACTGCAGCTAAAGACAGCGAGTCTGCAGATCAATTCATACTGGCTAGCGAAACGGTTGTC
CGTTTCGTACAACACTCTATCGCAGAGGCGGTAGATCGACAAAAACGAAACGCTGACAAGAATGGAAGGGAAAATGTTCTTTTATTCAGTAAAGGCGACT
TTGTCCTACTATTTATAAGAAACCTACCTTGACACATAGTGAATAACGTGGGTAGTAACTTGTTACTAGCCAAGTTCATCGGTCCATTTCGTGTGCTGCG
CCTCCTAGGCAACGCATATACGATTAAACTGCCACGTAAGATGCGCACGCATCCTACGTTCTACTTCGGTCGCCTAAGGCCATACTATCGATACGGGGCT
TCTTCCGGTGA