Description :
From Genome Similarity Track
Location :
contig_1:31575- 36778
Transcript NameFunction/comments
g4.t1hypothetical protein

Sequence
5203 bases(100 bases per row)
CTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCT
GTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCGTCGGGAT
GGATACCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAACGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGT
GGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCTAAGCCTTTGAGGCTGAAGGTTAACCTCTACGAAGGAAAAGAAGGGGGAAATCTTC
ACTTCTGGGTCCGAGAGATCGAGCTCGCTGTGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTAAGTGGTCGAGC
AAAGTGCTGGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCCTTCCTCCCGGCGAAC
TATGAGTACCGCCAGCGCTCACACTTCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGTATGAGTACATCCAGAAGATGCGGGAGCTTACCGCATCTCTGG
TGGGAAACCCATTCCATAAACACGGTGTTCATGGACGGCCTACGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAG
CGATTCAAATTGCTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAG
GGGCCCCTTCAACGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATGCGCTGTTTCGGCTGTGGCAAACTGGAGCACATGAAACGTGCG
TGTTCCGCGGGAGGAACAACCCGGCGATTTCCTTCCAAGCCCTTCGGTCCTAGGGGTCGCTGGCAAAAGCCACGACCCCGTGGCCAGGGGAACGCAGGGA
ACCAGTAGGGGCGGGGAGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAGGGCTTAGCCCCTGAGAGTCTCTGT
ACTCTCGAAGCGGAGAAGGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGT
CAAAGAACTTTGCACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACT
GGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTAATTCCACTGAACGATTCCTCGTTCTTGATATGG
ACAAGTACGACTTGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGTTGCTAC
TGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCAGAAACGACTCCGAAGAATTAGTTGCGGCAGGA
GCCGCAACAGGTGTCATGACACCGTCCACGGCGGGCAATGGGCCGCCACAGGCAATGCCGGTGGACAGGACTTCGAGTCCAGCGAGGGGAACTGCAATGC
CAGCAGTACCCACCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTGTCGACGCCGGGGGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGAC
CAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACC
CTTGAGTCACCACCGGGTGTGGGTAACAAAGGACCACGCTGTGGTGGGCATTGACGACGTCATCGCCGCCGTAAGCCGGTCTGTTGGGACAGACTGGAGT
CGCTACAAGCGACTCGGAGAGAGAGAACTCTCCTCAGGCACGGCCGGACGAAGAATTCTATCACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCG
GACTCCACAACATTGGCAGCTCTGCCTGAGGTGTCCGAGCTACTGAGCCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAATTGAAAGCCGGGGCAA
TCGCGGAGATGGTGCTCCTGAAGCCGGAGGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGGCGAGCTTGGCAAGAAGCG
CGCAACGCGTACGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCC
CAACTCCCACCTGACTGAGGAGTTAGGCACGAGGTTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCG
AGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCATGAGTCGAAGTCTCCGCACACGACGCCCACCTTCTGCGTTCGCAAGCCGAA
CGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCATCCCTCGCAAGGATGTGTTGCTGAACAACATG
GCGGGCTGTGAGCTTTTTAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTCACGGCGATGAGCACCCCGA
GCGGCATGCTCTGGGAGTGGCTAGTGATGACACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGC
GTTCACGCAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTC
ATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTATCGGCTGCTTCGTCAGCAGCGTCGACG
TTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATTTTCGCAAGTGGTTGGGCCTCGCCAACTACTTGCA
CAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAACCGTCATCAGGATGCATTC
AACAGCATCAAGGCGAGCTTGCAGTGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAGCCATTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCG
GTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCTGCCGAGAGGAACTACCCTGTCCATGA
CAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACTCCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGAGTCCTTGCGG
ACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGA
ACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATCGGATACGCCTGGCATATCG
AGATGATGATAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGCTAACGCCCCGCCAACGTGCCCGACTCCGTCGC
TATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCCCAACGAAGAGGATCTGAAGTATGACATCCTTC
AGGAGGCGCACGATGTGCCTTCAAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGT
CGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCCAGTCCCAGAAGACTGCTGG
AAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACC
TTGCTCCGGTGGCTGACTCCGTCACCGGGGAACAGACTGCAAGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCCCTGAGACTATTATCTCTGA
CCGTGACCCAAGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCACTTGCTTGGAACACACTGCTCATGTCCACGGCCGCCCGCCCGCAAACGGACGGCC
AGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGGCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGC
ACTCAACAACGGGGTACACGCGTCCACGGGGTTCTCCCCGTTCTACCTCAACGGGCTCCAGAACTCCCTGGTACCACTCACTCTCCGTGGTGACACCGTG
GCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAAAGCTCTATCCTCCCAGGTGTCAGAAGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCG
ACAACAGGCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAAAGGAGTACTCTGACCGACATGGAAGAGGAACTTAAAC
GTGTTCAAAGTGGACGAGTTAGTACTAGGAACCTACCACTAAACTCGGTCAGTTCCGTGCTCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGA
GGTTCTGAGCAGGCATGGCTCCGCCTACACGATCGACTTGCCTAAGTCGATGACAACCCACCCGACGTTTTATGTGGGTCGTCTGAAGCGCTACCACGAC
ACT