Description :
From Genome Similarity Track
Location :
Scaffold_83:31565- 34387
Transcript NameFunction/comments
Phymu_g3782cathepsin B, cysteine protease family C01A, putative
Phymu_g3783transmembrane protein, putative

Sequence
2822 bases(100 bases per row)
GGACATCAGCCGCCCCAGTATGCGTCCGAACGTGGAAAGACCGCGAGCATTTGCACCCAAAAGTGCGCACTTTACCACCCGCGAccgagtcggagctgct
ggagctccaggcCTTCCCGTCCCAACTGGACTGGTGTGACCGGGGCATGTGCACGCCCTCATGGAACCAGCACATCCCGCACTACTGCGGCTCGTGTTTC
GCCCACGGGGCGCTGTCTGCGGCCCAGGACCGCATCAAAATGCTGCATAAAGCCCAAGGGTACGTGGGTCCGGACGTCCAATTGGGTCGTCAGACATTCC
TCAATTGCGGTCCTGCCCACGGACTCTCGGACGGCTGCGGGGGTGGAGAACCTTCGGACGTGTTCGAGTTCATGCACCACTACGGACTACCGGACGAGAC
CTGCGTGCCTTACAGTGCTACGGACTACAAGAAATACACGGAGACCAACGGCACTTGTCCCCCCGAGGGCTACTGCATGAAGTaagtagtttttttttgt
ttgttttttgttGAAACACTAATTTATTTTACTATATTGTAGTTGCATTACGACGCCGGACCATCCTCAAGGCCCTCACTGCTTCCCAGTACAAACGGTG
GTACGTTACCGTGCTGCGGAGTACGGAAGAGTCTCAGGAGAACACGCTatgatgaaggagctgctaaATGGACCCATCACTTGCGGCATTGCTTGCAGTG
ACGAGTTCGTGTTCAACTATTCGGCGGGCGTTTTCCAGGATAAAACTGGATTTCTGGACATTGATCACGATGTGGAGATTGTCGGATGGGGGGAAGAAGC
CGATGGGACTAAGTTCTGGAACGTCCGGAACTCGTGGGGGACGTATTGGGGCATGCAGggcttcttcaagatcgTTCGGGGCGTGAACAACCTTGGCATC
GAGGCCGATTGCCACTGGGTACGACCCGATATCtccgacgagaagctggttTTCTCCAAGACAACACCACTTTACGGGGGTTCGCTGTGGGGGATTGTGC
CGTTTGCCAAAGACGCCGCGACGTCGCACCCGATCAACACGACGGCGGATGTTGTACTCAGTAACTTGCCATTACAGTCCGAAGAGCTTCCAGAAGGCGT
TATTATTGGGCTTGAGGGTGGTGAGGCGTCACCAATGGAGACTGTTTCGCTGCGCGTGGAGAAAAAAGATGTGCACGAAGTGGAAGAATCTACCGGTGGA
CAGGACGACAGTTTTGGGTTGTCACTCTTCGCGCTCGCGGCGGCCTTCATCATGTTTGGAATGTTCGTCAGCAACTTGGTGACGCATTTTTCACGCAACG
AGACGTATAACCGCTTGGTCTAAGTGAAGTTGTAGCAGAAATCAGATATACTTTGTGGATAAATTTGACAAAATGCTAGCGAGAGGTTGCAGCTTTTGAC
TGCAGATACGCGAGGTTGCAAGTACATAAAGTGTTTAATGGTCTGTATTACAATGCACGCACCTGCCATTTCGCATTCCACTCGTGCTGCGGCAGGTgct
taaaaaaaaaactttacTTCCACTGCCAGTGGACTTGATCCATCGATAACTCTCCTACAGAGGCATGTTCTCGCCCTTCAgtggagctgcaagtgcCGGT
GGCTTTAGCTCCCGCTTGGTGTCCAGCAAGTGCAGGTAGTTGGCCTGCAGTGGAGTGGACTTGCTCAGCACAAGATCCGTCTGCGCCAACTGCTCCCTCG
CCTggcgcagctcctccgtcAATGCGTCATAACGCTTTTTATCAAACTTCGACCTGGCCATCTGCTTCCGAAGGCGTCGAGTGTACACGTAGTGGTAGAT
ATTCTCATACTCGTATTCCTGGTTCGTGAGGCTCCACCAGGCATAGCCGATGATAGAGACACCGAAACCGGTGAAGTACGTCACAGGCTCCATGATATCC
CACGAAAAGTGAATGAACGACAGCCAAAAGTAGAGACCGAAGGCCCCCACAAGCGACGTGGACAGTCCGTACGCAATGACATTCGCCTGTCGGGTAGCTG
TCGCCTCCAATTCACGGCGTAAATTCACCAGAGCAATGTGCTCCggttccagagcttgaatcttggccaccagcgactcTCTCTGTTGTTCAAAGAGCTG
AGACGACAGAGGCGACAGTCCAATCGACTCCAAGTACGAATCCAAGATGCTGCGTGGCTGTAAGAACACCGAATGCGtcaagtcttcgtcgtccgactTG
CCAAAGTAAAACACCACTCCCGACTGGTGGAAAGCCTGTAGCACCTCGGGTGCCTGTTTCTTGGGGATTCCTCTCTCCTGGCACATCTGCAGGAACTCGG
GGTGGCTGATTTTCCACTTGCCCAGGCGCTCCAGATCGCTGCGCAACATGATGATTGCAGCTTTCTGCGCCACAGAACGGACGTCCAGGTCTCCGTCATC
TGCCAGACTCTGGTACGCGCTACCGGTGAATACCGGGGCTCGTACCGGCAGCACTTGGTCGTTCAGTAGTAGCTCGAAATCATCAGTCAAGACCTTCTGC
AGGGTATCCTCTGGCTGGAACTCTTCTCCTCTGGCAGACCGAATGGCTACACTCTGCACAGActtgtcttcagcttcaattTGGGCGATAATATCAGCCA
CCGTCGTCTCTGTATAAAGTCAAATGATCACAAAATATGAGAAAAATTATAATTTCTTTAACGCAGTCTACtgaaaaaagaaaaagaaaaataaGGTTAA
GACAAACCTACCTGGAGGGATACTGAAGACTCGCTCCTCGTCAAACCCGTTGAGAGGCAGAGGAACCGCCAGTGTACACGTTCCGTCGTGGTATTTCAGC
TCGATGGCGCGCGCCTTCCCGT