Description :
From Genome Similarity Track
Location :
Scaffold_33:315648- 319234
Transcript NameFunction/comments
Phyci_6415Hypothetical protein
Phyci_574155Hypothetical protein

Sequence
3586 bases(100 bases per row)
GATTTCTGCTGCTTGGAAATCGGCGGCTGTcacatccgcggctcctgcgcatatcatgtgaaccacgttgcgtgcaggtgagttgctgacgcgcgacacg
gtttcttctttggcttgctcacgtctgcatatgtgctttcgggcttgtttcgcttggacaggatcgcggtatagcttagccttaaacgcatccatgcgtg
cgtcttgccgttgcgagtgctcgataaagtggttaatgacaccggtttggtgtcggatgatcttctgtgcttcggtctcctcgattgggttgttagcttg
cttgtgtggttgcttggttgtgttatctttgttgccacagctcgcgggccgggttgtcaattgagccgaccaggcgaggagatccgcgatagagctgccg
ctgtgaagaacgcatgcttcgactcgcttgatcgtcggagcttctggattgtgttccttcagcccaggatagtgtggaagcacacaggcggtaagtgcat
cgaggacgagctgattgatgctttgacttgcagtttcaaggtcttggtaagtcgcaaacagaagccgctgagccaagtcgatcttcgtgcgtgtcagaga
gtcgaacgctttcagttgctggagcgacatatttgcgtcccgtcctggccgctgagtatcttgctgaccttgtggtcttgtttgctggtattgaagatgt
ggttaatccccatgtttgttgttgtcatgttccaggcgtcgcggtcgaagatccagtaagctgtcaaactcctggaggcgttcgcgtgctgtgtcccgcc
ccggcgaaacgagtgcgaagttaaggcagcaaccacgccggcgggtttggcgaagcggtcgaggacgcggttgacgtgggtatagatggtcggggttgtg
tccaggCCGGCGGTCTTCGGTGcggcaagtccaagcgtcgttgttggatggaccagcacctccaagagcggtacgtctggagacagttcgatggcgatca
ggcttggttgttgaggcaagttgtcgatggcgtcaggcgatggtgcagcctggatgaagagcgccagggtcatggccagcagcggGCACGTGCTGTAATC
CGGGTcgggaaacagcgagtggccctgctcttcgtgcgtatgcaaagaaggaaaagcaagtcaccagcgtctaccgacacgttcggtttgcggagaagcg
cgaggtcggatgcgcggccaaccaggtaccacaataggcagagtaaggcagcgtcttggtagtcgcttgaacaacttgcataaacatacaaatacacaag
cattcctttcagatcgctctttgatcagggtggtgtattagcgataaaaccagcaccatctctcttcatgcaaaagttgtcaagggttttcccatattaa
gcaaccgtgcctcaaatttaggacggtgctgagggaattgttcgagtaaccatagtttagcttgctggtagtattgcatcgaagtgtttcgagccaacgg
ttcgccttttttgtcctcgataaatgcaagatacatgccaaacttatccattacggatacaaaacatttccagtatcatcacgctcgatacaagtacgca
catatgcatcactttacattctcagacctcaggaacttctgaaatgttgcgacagccgtcgtcttggcgcgcttagtgttgccgggctcgagttcttcta
accccatgcttcccgtcgaataaaagcaaaatatgcgagtgatacgtagctgacttaatatttgaatgccaatacacatattttccaaggtgaaatacct
gatacgtcggaatggctggcttacaggacttacctaaccctattgatttatattggctatttggggtgattcctctaaaatgactggacaattattctca
cagtggacatcactggctgtttatatacagtcaaacctgtttatatgatcctccctatttgagccttaccatttatttgatgcaagctttgttgctacca
aatattttacttagtttttgtatacccgctgtttatatgtatacaaggcatatgagtcacattttggaggaccaaattaggtctaacctgtttatttgat
tctcactgttcacgaccacacactcttcaatgcccccactgctcaacgcccaacgcccaacgcaagccccctttcctcgcaatgtctcctcgcacctgtt
acaaattgctgggttaaaactcgcattttgggcggaacgatgctgggaagggtccgcgctgacacgaattATATTGAGGCGGTATGATGgaggagttgac
agcgattttatcgaagtgggagggcgctgtgagcgctagtgagtatctggcagcggacgaggacgtgcctgcgcacgagccagatgtgacagtggacgaa
gcagcaggaagtgatgcagtttcgcaggacgagcaggaggaggaggaggaggaccaggaacccacaattcaacctgccatcgctctgagacactgcatgg
agctgtctgcatttctgcttcaatgcggagagcagactgatagagaacgaagaactttacagaccgtgtccgctttggttcgggagactacggtgaaggc
aaagcggcagcgaattatgcgcgatttctttacgtgcaccacataattgtttttaactgagtccattttatatgagtcattgttgtagatggccaccaac
ggggcctcatataaacaggtttgactgtacaaagaaacgttgggtgtagtcagatagattgccatattCATCCATAACATATACGTGGTGATAACGTAGG
TTAGTCGGTATTAATACCTACGCAAGCGAAGGAATCACCGATACTAATGTGTGTGGTGTGTTTTATATTTTGCTCACAAATTAGTATAAGTGAGACTATA
TTTGAACACAGAGCAATTATAGTATACAAATTACAGAGGCTTTGTTTGTTCTATACAAATACATAGtaccgtacctcacaaatgaaatgcttaacaacta
acttgccatttcgccaaatcggtctgaaaaaatgctattttttaacaccaagaaagcggttcgaaaccaagtctaacaatactagtagtagtagtaggtt
ttgtacgcagttacaagcttacttcctcaatgcgaggTACACTGTTTTGGTAATAACACCTCAAACAGTAATTAGTGTCGCTAGAATGCGGTGAGACTAA
TTACGGTTTCAACGCTAGTTTTGGCGAGGCGTGGACATGAGCGCAACTCGGATGTATACATGAATCCTGTGTTTTGGTTCGGGAATGTCTTACTTCAGCT
TGCTGGTCGTGGGCTCACTCTGCTCGCTCTGGTGAGCGACGTCGTCAGGCGCCGACTCAGACTCTGATCCCAACGTCGAAGCCGACTCGTCCTCGACGGA
AGTTTGCTGGTATGGCGAATCCTCCGAGTCCTCCACAACCGGAGCCTTGGTAGCCGTCGTGGCCTTAGTAGCCTTGGTGGTCTTGCCCTTCACCAGGACA
GGGTCTTCGCTGCCAGAGTCCTCAGAGGCGCTACTCGACTCGCTGCCGATGTCTGAGGCACTGCCCAAGTCGGAACCACTGCCGAA