Description :
From Genome Similarity Track
Location :
contig_47:315642- 317889
Transcript NameFunction/comments
g9697.t1XP_009523397.1 hypothetical protein PHYSODRAFT_542020 [Phytophthora sojae
g9698.t1hypothetical protein

Sequence
2247 bases(100 bases per row)
CAGGCGTGAACTCAATACCGTGTAAAAGACCACCACCCTGTATGTTTCCGCACCTTGATCACGATATTGCTTGGAGTCTCCTTCTTCCGCTCGAACATGT
CTTCGGGGGCACTTTGGCCGTCAGCACAGGGTCTTGCGCGAACATACACCTGCAATGAAAGCACGAGCAGACGATGGATCCGTGGAGCTCAACAGCACAC
TAAATACTCTGCATGTAGAAAGCTATATCCAACCTTGACGTTCGCATTCCCGAGCAACCGAGTGTAGTCGGTAGTGACCTTGTGGTCCATGACAATAACT
TCTGTGCTCTCTTGGTCTAGATAACGACGAGCAGAGCTTTAAGATCGTTGCTTGGATGCCTCACGGGGGTATTTTCAGTTCGCGTTTCGCTCGACTTGCC
GGCGCCTCTTCATTAGAAAGCTGCAACGCTATCGCAATGGGGGTCACCACCAACAGTACCGCGCCGAATAGCTCGGTCGAACATCTGCACAATGTTCTCG
CGTATATCCAACAGCTCAGTGCTCAAGCTGCCGACGGGGGCAGAGCTAACAAGCACCAACAGATTCGAGTCACGCATTGGGCGCGGAAGCTCCGCAGCCA
GCCCACGTCAAACCCTACGTGGTTGAAAAGTGTGCTGGAACATGCTAATGTGCTGCTTCAAATGCTGCTAGAGGGCGTACGTGTGTGTCATCTTGGATGT
AGTAATAACGTTACATGTAGATGCCAAGATGATGCTAACACAGAGCGGTCTTAGGCGGTCGAGGAGCCTTTCACGAAAATGCCGCCCCAAGGGCCATTAG
CTGCACTTCCAAGGTGCCAGGTGAGACTCCGTGACGATTCCCTGTTTAATCCACACAACACATTCATTACCTACTTTGACCAGGTTGCACGTCTCGCAAA
GGCAGCAGCGCATTTCATCAGATTGCCAACAGACCGCACTCGAGCAGTACCGATTGGGGTGCAACTCAAGCCACCAAGACAAACAACACACAGTAACAAT
GCAGATGAGAGCGTACAAACTGTAGCTGATGTTCGGAAGGTAAGTCAGCAGGTCCAAACCCAAGAAGAAGACGATCAGTGGGAATGGCAGCGCGTCTGGA
AAGGTGCTTTCGACAAGATGCGCCAGCAGCTACAGCAGATGACAGAGGAGACCGAGGCACTAGCCACCGAGAACAAGGTGCGGTATCGTACTCCAATGTG
AAGGCTTCTATCCCTTTTTGATTCAAAACTACCGGTACGCAGGAGCTGCGTGCTCTCGTGGCAGGCTGCGAGAAAGCTCTGCAGGAAGCCGATCGGACTC
AGCGCGACGTTGTGGCCAAGCACGTCGCCGAGCTGGACAACCTGCGCGCTGTCCACTCCTTGGAGCTATCGGATCTACAAGCTCGACACCGGCAGAAATT
GCAGCAAGTGACTCTGCAGAACGACGAGAAGTTGCTCAGCAGACGACAAAGTCGCTTCATCCAGCCAACACCGAACAGCAGCAACTCTCCGGTGCGTACG
CAACTTGTATATTATCTAGTACTCGTCTTACCGTTATGTCGTTGCTATAATGCTCAGCCCGACGCCAACGCAGACTTCTTGCAGTACATCGACGCCTTCT
ACTCGGCCACTTTGCACCTCACGGCGCAGAACAAGGCCTGACAATTGACCAGCATACGTGGCAGTCACTTATACTTGGATGAAGTATACATAAATCCGCA
ATTAGCACATCCCGTCACTTTGCGATAGAGACTAGAGACCTCATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGTCCGGGCGACTTGCACCCGTTCG
TGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCGACTGGTACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCACAA
TCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGCTAATATTTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGGGGTTCGCTGCTGCTGTGTGTGG
GCTCATTCACCAACATGAAGTCGCAGGACATGAACACGACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCCTCGTGTCCGCCTACATGGGCAA
TATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGACGGCGGATGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTATCCATCAGGGGGAGAGTGCTGTA
AGAATGGAAAGAACCGAACTGTTTGATGGTGTTTTTGCTTTTTGCTA