Description :
From Genome Similarity Track
Location :
contig_1:31563- 36759
Transcript NameFunction/comments
g6.t1hypothetical protein

Sequence
5196 bases(100 bases per row)
CTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTTTGGACTACCTGAATCCT
CTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTTGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGG
ATGGATACCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAACGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTAC
GTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTCAGCCTAAGCCTTTGAGGCTGAAGGTTAACCTCTACGAAGGAAAAGAAGGGGGAAATCT
TCACTTCTGGGTCCCGAGAGATCGAGCTCGCTGTGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTAAGTGGTCG
AGCAAAGTGCTGGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCCTTCCTCCCGGCG
AACTATGAGTACCGCCAGCGCTCACGCTTCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGTATGAGTACATCCAGAAGATGCGGGAGCTTACCGCATCTC
TGGTGGGAAACCCACTCCATAAACACGGTGTTCATGGACGGCCTACGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAG
AAGCGATTCAAATTGCTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAG
TAGGGGCCCCTTCAACGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATGCGCTGTTTCGGCTGTGGCAAACTGGAGCACATGAAACGT
GCGTGTTCCGCGGGAGGAACAACCCGGCGGTTTCCTTCCAAGCCCTTCGGTCCTAGGGGTCGCTGGCAAAAGCCACGACCCCGTGGCCAGGGGAACGCAG
GGAACCAGTAGGGGCGGGGAGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTC
TGTACTCTCGAAGCGGAGAAGGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGG
CGTCAAAGAACTTTGCACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAG
ACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTCTTTATGAACCTGTCCGTCAAGTTTGAGGACTTAATTCCACTGAACGATTCCTCGTTCTTGATA
TGGACAAGTACGACTTGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGTTGC
TACTAACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCAGAAACGACTCCGAAGAATTAGTTGCGGCA
GGAGCCGCAACAGGTGTCATGACACCGTCCACGGCGGGCAATGGGCCGCCACAGGCAATGCCGGTGGACAGGACTTCGAGTCCAGCGAGGGGAACTGCAA
TGCCAGCAGTACCCACCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTGTCGACGCCGGGGGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGA
GACCAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTACCACACGGAGTCGATGGAACTCCCGACTCC
ACCCTTGAGTCACCACCGGCTGTGGGTAACAAAGGACCACGCCGTGGTGGGCATCGACGACGTCATCGCCGCCGTAAGCTGAGTCTGTTGAGACAGACTG
GAGTCGCTACAGAGAGAGAACTCTCCTCAGGCACGGCCGGCCGAAGAATTCTATTACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCGGACTCCA
CAACATTGGCAGCTCTGCCTGAGGTGTCCGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAATTGAAAGCCGGGGCAATCGCGGA
GATGGTGCTCCTGAAGCCGGAGGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGGCGAGCTTGGTAAGAAGCGCGCAACG
CGTACGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCATCCCAACTCC
CACCTGACTGAGGAGTTAGGCACGAGGTTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGTCACTGCCTCACGAACAGTGCGAGGTCAT
TGATGCCTTCTTCGTCGCGAAGGCAAAGGCAGGCATGGTGCATGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAG
TGGCATCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACAGTGCCCGCCCAGACACCCATCCCTCGCAAGGATGTGTTGCTGAACAACATGACGGGCT
GTGAGCTTTTAAACGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAACGGCAT
GCTCTGGGAGTGGCTAGTGATGCCACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACG
CAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCAAGGTGCATCTCGAGCACCTCCGTCGAGTGTTCATGGTCA
TGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTATCGGCTGCTTCGTCAGCAGCGTCGACGTTCGAGC
CGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTTCGCAAGTGGTTGGGCCTCGCCAACTACTTGCACAAGTAT
AGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAACCGTCATCAGGATGCATTCAACAGCA
TCAAGGCGAGCTTGCAGTGCGCGCCGGTTCTGGCCTTGCCGGACGAGACAAAGCCATTCAGCGTTGTCTGCGACGCCTTCGACTATGCCATCGGTTGCGC
GCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCTGCCGAGAGGAACTACCGTGTCCATGACAAGGAG
CTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGAGTCCTTGCGGACGGCCA
CCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCT
TGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTATATGATCGGATACGCTTGGCATATCGAGATGAT
GAGAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGCTAACGCCCCGCCAACGTGCCCGACTCCGTCGCTATGCGT
GGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCCCAACGAAGAGGATCTGAAGTATGACATCCTTCAGGAGGC
GCACGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGTCACG
TATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCCAGTCCCAGAAGACTGCTGGAAGTCGA
TGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCC
GGTGGCTGACTCCGTCACCGGGGAACAGACTGCAAGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCCCTGAGACTATTATCTCTGACCGTGAC
CCAAGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCACTTGCTTGGAACACACTGCTCATGTCCACGGCCGACCGCCCGCAAACAGACGGCCAGACGGA
GCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAAC
AACGCGGTACACGCGTCCACGGGGTTCTCTCCGTTCTACCTCAACGGGCTCCAGAACCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGTGGCTTCGG
TCGTAAGTGGGGGAGAGGCGCGGAAAGCTCTTTCCTCCCAGGTGTCAGAAGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAG
GCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAAAGGAGTACTCTGACCGACATGGAAGAGGAACTTAAACGTGTTCA
AAGTGGACGAGTTAGTACTAGGAACCTACCACTAAACTCGGTCAGTTCCGTGCTCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTG
AGCAGGCATGGTTCCGCCTACACGATCGACTTGCCTAAGTCGATGACAACCCACCCGACGTTTTATGTGGGTCGTCTGAAGCGCTACCACGACACT