Description :
From Genome Similarity Track
Location :
Scaffold_261:31560- 33168
Transcript NameFunction/comments
Phymu_g7697hypothetical protein PHYSODRAFT_475771

Sequence
1608 bases(100 bases per row)
GCATCTTTGGTTCAAAGTCTGACACTTGATGCTGTCGTCCGAGTGACATGGAGTATGGCGTGCCGCGTCGTTTCATGACCTCTGCTTACCTGCATACTAT
ATCAGGTATATACATGGATTCAACGGAAGGGTGGTCACTTTAAGTAACGGACAGTAATTAATAATGTGTGGTTGACTCTAGTGCATGGGAGCACAGAAAG
CGTACGAGTTGCTAGGTGTCCGCCGCAGGAAACATTGCTGCGTGGAGCTTTCGCCAATACATTTGCAGTGCGTCTGGCAAGATGATAACCGGGCAATGCC
AATCCAGCTGCAGACCACCGGGTTGAACTTTGAGACCACCACTTCCTCCGCCGCCACCATCTTGTCATTCTCCACTTGTCGACGTAGAGCGCAGACCCTC
GCCTCAACTCGCAGCAACATCCTCTCAACACAATGGGGTTTCGTCTGGGATTCGTCTTGGACGGAGGTGAGGCCAAGGAGCTTGTGCCGCTCAAGTTGCT
CTACGTGATCCACTacttcgccttctccatgcaGACGTATCTACCGGTACGACGCCAAATCTTGTGAATAGATACCCGTTGTCTTTGGTTCTAATCGGAA
CTATTCCAAGTAGATCTACTTCGACACGACCGCAAACTTCTCGAAAGCGCAGATCGGTGTCCTTCTTGCCATTCCATGCATTTGCGCTATCATCAGTCCA
CCGGTCTGGGGGGCCATCGCCGACGGGATCCACAACCAGAAGCTCACGCACACGGTGTGCCTTGTGTCGGCTGCATTCCTGTTCTGGTCGATCCAGTACG
TGACGTCGTTCCCGCTCATGTGCGCGATGGTGTTTATCGCCAACTTCCAGACGCAGCCGTCGTTTTCGCTGCTCGATCACGCGTCAATGGCGTGGCTAGA
GCGTGTTGGCGGAGACTACGGCAAGCAGCGTCTGTACGGAGCCGCAGGCTACGGCGCAGGAGGCTACTTCGCCAGTGTGGTGGCTTCGTCTCTCGGCATC
GAGTGGTGCTTCAACATGGTGCTCATTCTGTCGAGCATCtcgctgttcctgctgctgacgtACGTCCcgaacttccagcacgaagcagagcACCACGAGA
AGGGCGAGTTGCTCAAGAGTTTCAAGGCCATTCTCCATCAGCACGACGTGCTTGCCCTCTTCGTGATCGTCATCCTCGCGGGTATTATGGGAGGCCTCAT
TGAcaacttcctcttcttgtaCCTCTTTAACCTGGCCTCCGACAACCCGCACATCGTCGGTGTAGTCAtcgcagtggagacgatctcggagctgccgttc
ttcttctacgcCAACAAGATCTTCGAGCGCTTCGGAACGGCCAAGTGCATCTTCGTAAGCCTCGTTGCCTATGGCATTCGCATGATCACGTACGCGTTCA
TCCAGCACCCGTGGCTGGTGCTTCCGATCGAAGTTCTCCACGGACTGACGTACGGATTGCTACTGGCTGCGTTCACCAACTACATCTACCAGGCGGCTCC
AAAGGGAACGGAAGGCACGATGATCGGCGTGCTCTTCGCTGTTCAGCGCGGCATTGGTGGCGGACTGAGTACGCTCTGTGGCGGCTGGATCTACGGCGCA
CTGGGCGG