Description :
From Genome Similarity Track
Location :
contig_47:315592- 317839
Transcript NameFunction/comments
g9244.t1XP_009523397.1 hypothetical protein PHYSODRAFT_542020 [Phytophthora sojae
g9245.t1hypothetical protein

Sequence
2247 bases(100 bases per row)
GTCGAAGCTAAACGCGTGGTTTCCGTATTGCATCCGTTCTGTATCCTAAGCAGCACCAAATAATCAGGCGTGAACTCAATACCGTGTAAAAGACCACCAC
CCTGTATGTTTCCGCACCTTGATCACGATATTGCTTGGAGTCTCCTTCTTCCGCTCGAACATGTCTTCGGGGGCACTTTGGCCGTCAGCACAGGGTCTTG
CGCGAACATACACCTGCAATGAAAGCACGAGCAGACGATGGATCCGTGGAGCTCAGCAGCACACTAAATACTCTGCATGTAGAAAGCTACATCCAACCTT
GACGTTCGCATTCCCGAGCAACCGAGTGTAGTCGGTAGTGACCTTGTGGTCCATGACAATAACTTCTGTGCTCTCTTGGTCTAGATAACGACGAGCAGAG
CTTTAAGATCGTTGCTTGGATGCCTCACGGGGGTATTTTCAGTTCGCGTTTCGCTCGACTTGCCGGCGCCTCTTCATTAGAAAGCTGCAACGCTATCGCA
ATGGGGGTCACCACCAACAGTACCGCGCCGAATAGCTCGGTCGAACATCTGCACAATGTTCTCGCGTATATCCAACAGCTCAGTGCTCAAGCTGCCGACG
GGGGCAGAGCTAACAAGCACCAACAGATTCGAGTCACGCATTGGGCGCGGAAGCTCCGCAGCCAGCCCACGTCAAACCCTACGTGGTTGAAAAGTGTGCT
GGAACATGCTAATGTGCTGCTTCAAATGCTGCTAGAGGGCGTACGTGTGTGTCATCTTGGATGTAGTAATAACGTTACATGTAGATGCCAAGATGATGCT
AACACAGAGCGGTCTTAGGCGGTCGAGGAGCCTTTCACGAAAATGCCGCCCCAAGGTCCATTAGCTGCACTTCCAAGGTGCCAGGTGAGACTCCGTGACG
ATTCCCTGTTTAATCCACACAACACATTAATTACCTACTTTGACCAGGTTGCACGTCTCGCAAAGGCAGCAGCGCATTTCATCAGATTGCCAACAGACCG
CACTCGAGCAGTACCGATTGGGGTGCAACTCAAGCCACCAAGACAAACAACACACAGTAACAATGCAGATGAGAGCGTACAAACTGTAGCTGATGTTCGG
AAGGTAAGTCAGCAGGTCCAAACCCAAGAAGAAGACGATCAGTGGGAATGGCAGCGCGTCTGGAAAGGTGCTTTCGACAAGATGCGCCAGCAGCTACAGC
AGATGACAGAGGAGACCGAGGCACTAGCCACCGAGAACAAGGTGCGGTATCGTACTCCAATGTGAAGGCTTCTATCCCTTTTTGATTCAAAACTACCGGT
ACGCAGGAGCTGCGTGCTCTCGTGGCAGGCTGCGAGAAAGCTCTGCAGGAAGCCGATCGGACTCAGCGCGACGTTGTGGCCAAGCACGTCGCCGAGCTGG
ACAACCTGCGCGCTGTCCACTCCTTGGAGCTATCGGATCTACAAGCTCGACACCGGCAGAAATTGCAGCAAGTGACTCTGCAGAACGACGAGAAGTTGCT
CAGCAGACGACAAAGTCGCTTCATCCAGCCAACACCGAACAGCAGCAACTCTCCGGTGCGTACGCAACTTGTATATTATCTAGTACTCGTCTTACCGTTA
TGTCGTTGCTATAATGCTCAGCCCGACGCCAACGCAGACTTCTTGCAGTACATCGACGCCTTCTACTCGGCCACTTTGCACCTCACGGCGCAGAACAAGG
CCTGACAATTGACCAGCATACGTGGCAGTCACTTATACTTGGATGAAGTATACATAAATCCGCAATTAGCACATCCCGTCACTTTGCGATAGAGACTAGA
GACCTCATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGTCCGGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCG
ACTGGTACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCACAATCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGC
TAATATTTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGGGGTTCGCTGCTGCTGTGTGTGGGCTCATTCACCAACATGAAGTCGCAGGACATGAACA
CGACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCCTCGTGTCCGCCTACATGGGCAATATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGAC
GGCGGATGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTATCCATC