Description :
From Genome Similarity Track
Location :
Scaffold_323:31553- 37271
Transcript NameFunction/comments
g11981.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g11982.t1hypothetical protein

Sequence
5718 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGAATACATTCGGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGCTCTGCCATCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTCAGCACCAAAGCTATTGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACT
TAAGTAAATCACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGT
CCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCTGTGGGTAGCCCAAACACGTCT
GCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAATGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAA
CGATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTAAAACCGCTGCTCGAACTTCGGTGTGGCC
GATGGCGACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACT
GCCATAGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGAC
TCACGGACCCTACGTGCTTCATCACGTACGAAGAGTTCAAGGAGGAGCTCAGACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTT
CCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTTGAACATCGTGACCAACCCGATTGACGAGGCGACA
AAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCCAATACTCTCGAAGCTACCATTGCGCTCGCAA
TGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAAT
GGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAGTGTGCGTTGTTTCCGCTGTGGAAACATCGGTCACTACGCCCGCGAG
TGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGACGCGGGGCGCCC
TGCTGGTGATGCGGTCGAGCGTGTCGACATCAGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAG
CCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCC
TTCCAAGACTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGAAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACG
CGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGCTGGGCATGCCGTGGCTTGCA
CGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATG
CACCGCATGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAA
AAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACA
CAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCATCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAACCGTC
CCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGACTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACC
CGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGTTCCGCACGAGAAGTGAACGGCGCAAGCGATCA
AAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACACTGAGTGTCTTGA
CGCGTACAAGCATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCG
TTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGCCGAGAGGGTGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATC
TCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACAAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGC
GTGAGTACAAGGATGTACTCCCGGACGATAACAAGGTACAAGGATGTACTCCCGGACGACATTCCGGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACG
AGGTTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGACGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCG
CAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAGCCACAGGGCGGGTAGCGCATCGTTCATGCGTACAAC
AAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATATCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATC
TGAGAGACGGGTTCTCTCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCC
GCAGGGGCTAAAGAACGCCCCAGCGACGTTCAACAGGTGCATCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTC
ATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCACACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGTACAAGCTTTACGCGA
ACCTGAAGAAGTGCATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGAT
CAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTACGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATT
CGCCCGCTGTCGCAGCTCTTGAAGAAAGAGGCTGCATGGGAATGGCCTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGC
CGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCTCGATCGGATGCGCACTGATGCAACACGATCACGAAGG
TGGTCTACTACCAATCGTGTCAGCTGAAGCCAGCTGAGCGCAACTACCCAGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTTG
AGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGTACGG
TGGCTGCCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGG
TGCAAGAGGCCGACGCCACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGGTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGAT
GCGAAGCAATTGGTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGCGTACACCGTTATCGTGTACACA
ATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTATCACGA
TGCCCCAACATCGGGACATCCTGGCAGTGAGAATACATATTTACTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTT
CGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGTTCCGCTACAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAA
TGGACTTTGGTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGTTGCATCTTGCTGCAGTACC
AGCCGAGGTGACAGCCAAACAGACGGTATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGC
TTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTACGGATCACCCGCAGACGGACGGACAAACAGAGCGTG
TCAACCGCGTACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCG
ACAGGACACATACCGTTCTACGTAAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGGTATCCGG
TTAATTCGAAACAACCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGT
GTCTACGACGGGCGTAGACACTTTAAACAACAACGAACATCACGCGCAGGCCGGACCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCG
GATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGGATGCCGATAACA
CCGGCAGAGGAAACACAAATGAATTCAAAGTTGGTTAATTAGTTCTGTTAGCTACACAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAA
GCTTGCTCCGCGCTTCAT