Description :
From Genome Similarity Track
Location :
Scaffold_2:3155- 4897
Transcript NameFunction/comments
Phyta_totarag102myosin-like protein

Sequence
1742 bases(100 bases per row)
caagaagacggacCAGACGATTCTTGTGAGTGGTGAAAGTGGCGCCGGTAAGACGGAGACCACGAAGCTCATTATGAACTATTTGGCCTACGTGTCGACC
AAACGCACGCGCCGCCCGATTCAAGTGAGCAATTGTGACCAAACGACTATTCATGACCGAGTGCTGGAGTCGAACCCGATTCTAGAGGCGTTCGGTAATG
CCAGAACCACGAGGAATAACAACTCCAGTCGCTTCGGTAAGTTCATCAAGCTGGGTTTTACGTCGTCTGGTGAGATGCTAGGTGCTTCTATCTCCACGTA
CCTGTTGGAGCGCGTGCGCCTCGTGTCACAGGGCAAAGGCGAACGCAACTACCACATTTTCTACGAAATGTGTAGCGGCAGCTCTCCGTCAGAGCGTCAG
GAACTGGCACTGCGGGACGTGCATGAGTACGCGTATTTAAATCAGTCCGAGTGTTACGAACGTCTGGACGGTGTGGATGATGCCGAATCCTATCTCGTGA
CTCGAAGAGCCATGTCAAGCATTGGCATGAGTACTGATGAGCAGCTCAATGTGATGAAGATTGTTTCTGCAGTGCTACATTTGGGCGATGTACGTTTCAC
GACGGCCACGCGCAATGGCGGAAAGGATGATGCGTCTGTCGTGGACATGGATGAGTGCGGTGATAACATCCGAGCCATTTGCTCGCTTCTTGGTGTGGAG
GAGGACGTACTACGCAGTACGTTATGCACAAAGCAAATCAAGGCTGGCGCTGAGTCCATTACGACTCGCCTTCCGGTTGCACAGGCACTCTCGACCCGAG
ACTCAGTGGTCAAGACGCTCTACTCAAACCTATTTAACTGGCTTGTGGACCGTATTAACCGGAGTATCGAGTACAAGGAAGAAGCGGGCGGTAGTCAGTT
CATTGGTGTTGTTGACATTTTCGGTTTCGAGATTTTTGAGCAAAAccgccttgagcagctgtGCATCAATTATGccaacgagaagctgcagcagttaTTC
GGTAGGTTCGTGTTCCGTATGGAGCAAGACCAGTACGTGGCGGAGGAGATCCCCTGGAAGTTTGTGGACTACCCCAACAACGATGTGTGCGTGGCACTTG
TGGAAAAGCGACACATGGGCATTTTCTCTCTTTTGGACGAACAGTGTTTGATCCCGCGTGGTAACGACGAAAAGCTGGCAAACAAGTACTACGAGTGTCT
AGCAGACAAGCACGAGAGCTTCTCAGTGACCAGACTTCAGCGCGCAAAGGGCCAGTTTGTGATTCACCACTATGCCGGCGATGTCTGCTACATGACGGAT
GGTTTTTGTGATAAAAACAAAGACCACATGCACACGGAGGCGATGGATCTGCTACGCACTTCCAAATTCTCCTTTGTGCGTGCTTGCTTCCAAAACAGTG
TCAACGCTGCTGGTAACTCTAGCCCAAGGAATGGTCGGACGGAATCTCGCGGTAGCGACGGTAatcgtcgtcgatctggTGGTATTTTGTCATCCACGGT
TGTTGCGCAGTTCAAGAGCCAACTGAGCTCACTTTTGGAAGTGTTAAATGCAACGGAGCCTCACTTTATTCGTTGCATCAAGCCCAACGACCAGGCGAGT
GCGTCACAGTTCGACCGGAGGCGTCTATTGGAGCAGCTACGCTGCAGTGGTGTCCTGGAAGCAGTTAAGATTTCTCGGAGCGGCTACCCTGTGCGTTTTC
CTCACGATGTATTTATCAAAACGTACAGCTGCATCTTGTCCC