Description :
From Genome Similarity Track
Location :
contig_5:31543- 36636
Transcript NameFunction/comments
g1608.t1hypothetical protein
g1609.t1hypothetical protein

Sequence
5093 bases(100 bases per row)
TACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGT
TCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGA
GCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAA
AGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGA
CCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGC
CCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGA
TCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTG
GGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATG
AAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTC
TTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATT
GGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATC
GTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCT
TCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGC
GGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAG
GGTCTCGAAGCGTCCGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGAC
GCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACG
AAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGA
AGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCT
GCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCC
TCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTC
TCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCG
ACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCA
GGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGAC
GACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGC
GCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTAC
TATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGCGGTAAGCACTCCGAGCGGCATGCTCT
GGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAG
CTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGA
AAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACC
CAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAG
CAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAG
CAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGA
TGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCT
TGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAG
TCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCG
ACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGA
AGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTT
CGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGC
TGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAG
TCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCG
ACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCT
TCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCC
ACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGAT
CACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGC
CGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACT
CGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACT
CGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTG
CTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAAT
AGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGA
ACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACAC
ACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGA