Description :
From Genome Similarity Track
Location :
scaffold_349:3154- 5593
Transcript NameFunction/comments
Pl_105782hypothetical protein PHYSODRAFT_320750
Pl_105783hypothetical protein PHYSODRAFT_467172

Sequence
2439 bases(100 bases per row)
TGTATTTGCATATAACAAGTGCTACGCGGACTTGCACTTGCTTCTGACGGTACCTAAAACTTTCGTGAGCTATCTTCCGGTCGAGAGTTAGCTACTCGCC
AACGTCACCTGCCATTGATAATGAACTCTTCGAGTCGTCAGTGATAGCACTGTCATCCGTCGAACCGCCTTGCGAATCGGAGGTCGAATCGGCCAGTGAC
TCACTGAGTGAGTTGTCCAAGGAAGCATCTAATGAACCTGACCCAGGTACGAAAGAGCCATCAAAGCTGTCTTCTGGCTCGCTATCCTGTTCAGATCCAT
CTGATGCTGAGCTATCAAACAAGCTTTCGAATGTAATATCATCCGTAGAGGAGGAGGCCGAGCTGTTGTCCAAGCTGCCTACCCAGACTTCGGGCATAAT
CTCATCGGAAGAGGAAGCGGATGAACTGTTGTCCAAGCTGCCTACCCGGTTTTCGGTACTAATATCCTCAAAAGTGGAAGCAGACGAGCTGTTGTATAAA
CTGTCAGTCGAGATTTCAGGAGTAATTCCGTCCAAAGAGGAGGCAGCTGAGCTGTCGTCCAAGCTGCTGGCAGGTTCGCCTGTTTGGGAGTCCAACGAAC
CAGTAGTTGAGTTGTTTGATGAGTCTGTCGATGTGGAATCAGACAAGGAACCTGAATTGTCATCGGCTCCTGAATCATGCTTCGACCAAGATGATTCACG
CCCGACAGTACCAACTCCGGAACTGTCCGACCCACCAATGATTGACACACCTCCAACATTGGCGTCAGCTGTCTCTGCACTGGTGGTCTCACTTGACGAA
TGGGAGCTCTTCAAAGTCACGATCGCAATGACTCCGAAGATTACACCACACACTGCGAGTAACGTGATCGCTCCACGAGTGCTCCACGGACGTGGCATCG
GGACCGATCGTAGCACTGGAATTCTCGTCAGCGCTCCACCTTCCCTTTCCTCGAGGCGATCGAAGCCACCGTCGTTCGGATGATACAGCAGATTGTTGCT
CTCGGTCATCATTTTTGTGTACTTGTTCGGCTTGTAGCAACTTGGTCGTTGACTGAGCAATTACAGTCAAGTGGAGAAATGGCCAACGCCACAACTCACC
CCTGTCCATCAATACAAGTCCGTTGAAACGGGTGAGCGATCGCATGTCAATATTTCTGCACCACAAAAAGCCAGGAAGAAACCAACATGATCCTAAGATT
ATCCAAACATTCACTCCTGCTTCAACTTGCCTTTATGTACACCACACTATCTCTACAATTACTACACATCAGCTTGTATCTCTAGCCAAAATTCGGTGTC
TTCCTGACCACAGGCTCCATAGTCCGAGCACAATGCTCCGCACGCTCCTCACTGGACGCGGCAGCTTGGTACGTCGCCCACAGGTGACTCCAGCGGGTAA
ATTCACCACTATCCGATGCGCTAGCGACTCTTCTCCCACTCTGTTCGAGCGTTCCGCCCGAATTAACTTACATAGCGCACGCACTTGGGTCGAAAAAGTC
GCTCCGAGTCTGCAGACCTTCTTGGATCTAGAGAAGCATCTGATGATCCCTCTCAAGTTCGTAGTGCCGTACGGAAGTCCAAGATGGCCGCAAGAGGCCT
GGGGCTATCCGCTGGGTATGCATTGTAGGAACCTACGCGTACTCAAGCAACAGGGCAAGGCTCTTCCGTTTTTCACCATTGACGACCTGGAAACACTCGA
CTTTCCATGGGACTTGCGGCAATACAAGTGGGACGTACTGGTGCTCCCTTCACTCAAGAGATACTATGAAATTAAAGGTGATTGCGATATCCCCACCGCA
TTCGTGGTTCCTACGGGGGATGCCACTTGGCCGAAACTTTTGTGGGGATTCAAACTGGGGCAAACTGTCACGAGTATGAGGTATGCCGACGCGTACAGAG
TGCAAAGGGAACGTTCTCGTGATGAACTCGAGAAAATTGACTTTTCGACGTTGAGGTGGAGAGTTCGGATGTGGGAAACCAAGATTCTCCCGGCTTTGGT
GGCGTTTAAAAAGGAGTTTGGACACTGCAATGTGCATTTCCATTTTGTTGTGCCAGATAATGAGAAGTGGCCGAAAGCGACCAGAAAATTGAAACTGGGA
CCGACAGTCGCAAACATGCGTAGCAGAGATAACTACGATGACTTGGCGGAGCGAGACAAGGAGATACTGAAAGAGATTGGATTCTGTTGGAATCCGGAGG
ACGAACGATGGACAAACGTGATCATGCCGGCGTTCGAGACATATCAAGAAATATACAAGTCTGGATGGGTATCGGCTGGGTTCGTTGTTCCCTGTGAGAA
ACCTTGGCCAGAAGCATCGCGTGGGATGAAATTGGGCAGCATTTTCATGAAGGTCCGGCATACAGGGGCATACTCTTCGTATGTAAATAGAGACAGAGAA
CGTCTGGACGCTCTTGGAATTTCCTTCAACACGCGCTAC