Description :
From Genome Similarity Track
Location :
Scaffold_38:315362- 317085
Sequence
1723 bases(100 bases per row)
CAGCATGCGCTTGCTGGCCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGAAACAACAGCTGATCTTCATGGAGTTCCCGTAACTCC
GTGGGTGAGTACTTAAGAGACTCCGCCCATGCCCAGAACATGTCCTCACAAGTACGCCACGTGGGACAGTTCTCGGGCATAACTCAGGGGTATCCCCGAA
GAGGATAGAGACCGCCCCGGGTCTCGGGCTTCTTGCGACAAGTCGTGAAGTCCTTGAGAGGGATGAGGTGTGGCGCGAGAAGCACACACCGAACAGCCTC
CATGTTGTCAACGAGCAACTTTTCTTTCTGAACAAGGGCACGTTCGTAGATGCCCCTAGAAGTGTGGCCGCCCAGAAGGCCACGCGGAGCGACGAGAAGC
TCTAAGAAGAGGTTAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCTTCGAACCCCGAC
GCACACGCTGGTCAGCTTGGAATTCCTCCTGCTGCTGGTTGAGGTCATTCCTGATCTTTCGGGTCTCAGAGATAGCACCCTCTTCCTCCTCCTTCTCTTC
CTCTTCATCCGAGGAATCGAAGAGGTACCGATGGGAGTACCGAGTCTCCTTCTCCTCGCGGGGTGGAGACTTAGAGGCCGTACGCTTCTTTGAGGGCTTG
GCGCCTTCGGGTTTAGAGGCCTTAGCCCGCGCAAGACCCTCGGCAAGCGAAAGACATTTGCGAGGATTCTCTTCCTCATCGCCGCCGGCTTTGGGAGCGC
CCTTAGCCTTGACGACCGGACTCTCAGAGCGCACAGACGTTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGGTC
ACTGGGCACTGGGCTGTGCCCTCCCATAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCATCGTCCTCACTGCCAGAGTTGAACTCACGTTCC
ACGAACCGAGGGTTCGGACAAATGTCTGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTCGCTTGCCCACAGCCGCGGCACCCGAGGAACCAATCG
CCTCAGAGGCCACCTGAGTAGCCTTCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTATTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGT
CTTAGCACCGCTCTTTGCAGTGCTACGAGGCATGGTAACGGTCGAATTAGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCGAACTGTGAA
GTGAGCCTCCGCCGCGCTCGCGCGGCCTAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACC
GAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTGAGTGTACCCTGTTTACATGAATTGTGACACGTCATACTTCGGGATATTTGGTACAAGGT
ACCAAGGTTTGTTCAAAGTCAAACATTGGTTGATGACATTGCATTTCTAAAAGTAACTTACAGTTTGTATTAAAGCCAAACTTAACCTACCTATAAATAT
ACTCAGTTTACAATCTACCTTATTTAAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGATAGTTTGTATACTCTGGGAAGATAACTTCCTCTAGCGCA
AGGTGCTGTGTGACCCCGTCACA