Description :
From Genome Similarity Track
Location :
Scaffold_45:315349- 316841
Transcript NameFunction/comments
Aphas_H257_13323transmembrane protein, putative

Sequence
1492 bases(100 bases per row)
TCGCCCAGTATGGGGCCATAGGAATCCTCTATGGCACCCTGCCAGGCCTTGGCTACCCCCTCTTCCAAGTGTACTTAAACCTCGAAGGGTACCAAGTCGC
GGCCTTCAACATCCTCGTCAACATTGCGTGGTCCTTCAAGATCTTCATGGGGGGGTTGAGTGATTGCGTCGCCATCTACGGCTACCGTCGCAAGCCATGG
ATGATTCTAGGCTGGCTGGTTTGTCTGGCGGGATTGATCTACCTCGTGTGTCTGTCTCCTGGTAAGCCGTACTGCGAAGCCCGCGACGATGACAACAACT
GCCGCAGCCTCATCAACCCCAACACGGAAGCCACGTCCATCCGGATCACACTAGGCACTGTTGTCGCGACCTTTGGGTACGTTACGTCCGCCTGTGCGTC
CGACGCCCTTGTTGTGCAGTACGCCCAACGCGAGCCCGTCCACAGCCGAGGCCGCATCCAGACAGCCATTTACACCGCGCGCACGATAGGCCAAGTGGTC
AGTAGTGTCTTGGTCGGCCTTCTTCTCAACGGCACCGTGTACGGCGGCAAGTTTGACTTCAACGTGTCTGTGAATGTGCTGTTTGCGATTTTGTGTGTGC
CCGCGGCGTCGGCGCTGTGCACTGCGGCGTGGGTCGTCGTCGAGCGCAAGACGGAAAGTGTGCCGTTTCACAAGTGGGCCGACCAGTTCTGGAAACTCTC
GCAGAAACAAGCCGTGTGGCAAATCCTGGCTTTCCGGTTCCTCAGCAGCCTCTTCCAGAACTTTGAGTCCACCGCGGGCAAACCCATGGCGCTGTATTGG
GCCAAGGTGCAGCCGTTCACGGACGCCCTCACCCACGCCATTGGCTATGTGCTGTTTTCTGCAGTTCTTGCGTTCGTGGGGCGATATGGCCTCAACTGGA
ACTGGCGGTGGACCATCGCCATCACCACCGTCGTGCTTATTGCCATTGATAGCACCGTCTACTTTTTGACCATCTGGGACATCGTGCGCAACCCGTGGTT
TTACACGGGCGTGACCCTCACCGACGAGATCCCCACCGGCGTCCGGTTCATCGTGTCTGCGTTCGTCGCGACAGAATTGGCCGACCTCGGCAATGAAGGC
GCCGTCTACGGAATGGTCACGACTGTCAACAACCTCGCGATCCCCGTCTCATCCGTGCTCTACAAGTATGTCGATAGCCACCTGGACTTCAACAACACGG
CGTTCGCGACTGAAAGCGTCGGGTCGGACGCGGACAAAGCCCGCGTCCGGTGGGCAGTCTCGTACTCGTATTTTATCTCGTACGCAATGAAAATGCTGTC
CCTGGTGTGGCTGTTCATGCTGCCCCCCCAAAAAGCCCATGTCCAGCGTTTGAAGCGACAAGGGATGGTGAGCCCGCTGGCTGGGCGGTTAACGTGGGCG
TTGTTCCTCGGTCTGCTCGCGTTTTCGATCGTGGGCAACGTCGCGTCGCTGTTCAAGGACACCTCATGGTGGCACATTGCGGGCGGCAACGG