Description :
From Genome Similarity Track
Location :
scaffold_42:31530- 33293
Transcript NameFunction/comments
g11236.t1 hypothetical protein PHYSODRAFT_471542
g11237.t1 conserved hypothetical protein

Sequence
1763 bases(100 bases per row)
CGACGCCGGCAGCACTGCCGTCTCTGTGGCGAGGTGGCCTGTCGTCGGTGCATGATAATTCGTGATGCACCATTGCTGAATGATAACGCTACTGTGGCGC
CACGGACATTCCAAGTTGTCAAGACGATGTTCTGCAAGGCTTGCATGGGGAAGGTTCGAGGCAGCGAAGTCAAGTCTATCACCAGCGGCGACAGCCAGGA
CGAAGGCGTATCGGACGCCGAGTCCATGAGCTGGTTCCCGGACAAGTCGCGCACTCGAAGCTTTGACAACGATACCAACTTCACAATGACTGGCGGCTCG
TCAATCGCATCTCTCTCGCCTACAGGTGGCAGTTCTGCTCGCTCCGCCCCACCGCAAGATGGCATTGACGAGGATGGCGGCGATGAGGAAAGCAAAAGCC
TTCAGAAGTTTTCGAGCAGCATCAGCTCGGAGGTGCAGTCTGAAACGAAGACCAGCGTGTCGTCTTCACTAGACGATGAGGTTGAAGTGGAGGTGGAGGA
GGTCTCGGAGCCCGTTGTTCCCATGATGATTGACCTGCGTCACCTGCGAACCATGGCTGGAGCGGAGCGTGTGGTTCAAGAGGTCGAGGAGGAGGAACTT
CGTACAATGCGCGAGTCCCTCGCGGCGCTGGACTTCCAGACCGTTCGCCTTGTATCTCCGGTGACTGCAGACGGCGACTCACAAGAAGGGTTTTCCAGCG
GCCAACTACCCATTATGGAGGAAGACGACGTGATCGAGGTGGAGGACGAGCCCCACCAGATCGTTTCTGCCACCCGACAGATCGTGTCGTCTCCTCTCGA
TGATACGCCGCTGAACGGGGGGATACTAGCGGAGCAGCCCCTGTTCGGGTCCTCTCGATCGATCGGTCAGTGTCTTCAGGAGCAGGAAGTGCTGTTAAAG
CGCCTCGTAATGGCGGCGAACTCATCAGCCGGGTACTGCCCACCCAACGCCCGCGGATAATCGAACCACAAGGAATCAACAACAACTAACGATGGCTTCC
CGTGTAGGGTAGCCACGTACATCACGTAGTGTTAGGACTATCGAGTGTATTACCATTTACTGAATCAATGTTTCAGTGGTCTAGTTGCTCGTAAGAAGAG
ATTGCACCAACACTTTAACATTTTCTTGCATCGTCATGGCAAAGAGTGCAAAACCTTCCAGCGGCTTGAGGTCAAGTCAGCAGCAAGAAACGCCATTGCA
CTTCTACAATCGGCGGCAAATGCTCCGGTGTTGTAAGTTCCGCCCCGGCGATCACAAAATGACTGGAAGCGTCGAGACAGGACACCGGTGAAGCTTTTGC
TCTGGTCGCGGTGCAACCCGAACTTGCTGCGACCGCCTTACCATCGGCCCCGGTGAACACCATGCGGGTACGAGGATTAAGAAAAAATCTTTTACTACGG
CGAACGCCACTTCAAGACAAGTACCGGTACATGCACGCTCGTCCGTGCAATCGGAATCTATAGTTGATGAACGACGGGCGAACTTCGTGCGTGCGTTGCG
ACTATCCAACGCAGCTGCACTTGCTCCGTCGCGACAACAATGCAATAAAGGTTGAGATCTTAAAGCGCTGCAGGCTTATGGCTGTCCTGGGCGGCCAGCA
TCAATCGCCTCAACAGGTTTTCTTGCTCGGCGATGCACTGGTCAATGGTGCGCCTTGATTCTATCTTGCCGGAGCTGTCGGGCTGCTGGTGCGCGGATTT
GTCGTCGAAGGAGGCTCCAGCGTTGATCCGGCGCATCATTTGAGACGCCGACATTAGGTTTGA