Description :
From Genome Similarity Track
Location :
contig_124:31526- 32584
Transcript NameFunction/comments
g13508.t1XP_009534754.1 hypothetical protein PHYSODRAFT_258942 [Phytophthora sojae

Sequence
1058 bases(100 bases per row)
GATGGCGTACAGGATGACACCGCAGCCGATCATCAACACCGGCGTGTCCATCGTATGCGGCGCAGTCGCCTCCGCGTACGCCATCGTCGGCGCCAGGATC
AGCATCGACAGCAGCACCTGCCAGAAGTTGTCGAACGCGGCGTACTGCAGCGCAGGGAACACCAGCCCAGACACGAACACGCACGCGCTTCCCTCCCAGC
TGCGCGTGTACTTGTTCTTGCTGAAGCAACTGCGCGTCTTGTACTTGTGCTTGCCCCACGTGATGCCCACGGGCTCCGCCAGACCGTCGCCGATTCCCGT
GATGAACACGAGGATGAACGTCAGCGCGCCCTGAGCGGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGAGCGATGTTGCCCACGATGATC
CACTTGAGCGTGTTCGGGCGATCCTCCGGACGATCCAGCGAGTTGAACTGCAGCATGAAGAACTTGGAGTGCTCACGGATGGGCTTGATGAGCACGAGGA
AGCCCAGCATGGTGAAGAGGTCGCCCCAGGCCAGGGCGATCGGGCCGGAGTAGTCGGACTTGATGACCAGCGGCACCATGTAGGCGGCGAAGTGCTGCAG
CTTCCGAGTGTAGTTGACTTTGAACTTGGACGACTTGTTGGTCATGATGTAGCCCTTCTCGTCGACGTCGCAGAAGCAGCGGCAGATGATACCTCCGAAG
AGGGACACGACCATCATGACCACGAGCTTGGGCAGCTGCATGAGCCAGAAGTGCGGGTCGAGAAGCCACTGCGGCTCGTAGAAGAAGGTGAGAACCAGCA
TCACGGCAGCGTAGACGACCATGCCGACCAGGAAGGCGAAGTCGAACGTGTTGTACCAGTGCTCCTCGTAGTCACCGGCCACCTCGCCCTCCTCGACGAG
CGAGGTCTTGACGGCAGTGATGGGCTGCAGCTGCTCGCCCGTGGCGCCGTACGAGGGCACCGGAGCGCGCACAGGCAACGGCGTAGGCACGCGCCACACG
AGGCGCAGCATGACGTAGCACAGCAGCAGCGCCGCGATGGGCAGCGCAACGAGCACGA