Description :
From Genome Similarity Track
Location :
Scaffold_229:31521- 35237
Transcript NameFunction/comments
Phymu_g7181ser/thr kinase

Sequence
3716 bases(100 bases per row)
AAAcacaccagcagccaccagAATGGCTTGGAGAAGTTGCGACGCGATTTCCTTCACCAGGATCATGCTGTTCTCGTCCTGGGCGAGCGCATACACGATC
GGGCGGAGATTGTACTCCACGAGGAACTGGATGGGGGACGTGTGGGACTCGAACAGGCTCTTGAGCATCTTCAGCAAGTTCTTGCGCACAATGGCCTTGG
GAATGAGCCGCAGTCGCTTCAAGATCTCCGTCACGAACATGCCACTGCGTCCAAGTGCCTGGTTCAGTCTCACAGAACGGCTCATGATCTCCAACAGCGG
CTCCAGCAGGTTTTCCAGCTCTGTGTCCAACGCATTGTGGAAGCAAACCATGATCCTCATGAGATTTTCAGGGACGAGCAGTACattctccatcttcacc
gTGTCGTGCACTAGCCAGACGCTGATAGACTTGATCGCATCAATTTGCCAGTATTTATCCTctagcagctccaagaagactGTCACGCTGTCGTACGTCC
ACAAATGGGCGCGTGCTGTTGGCGACGCATGGGCCAAATCGCACAAGATGGGGAGTGATAGCTGCTTCAATGGACTCGAGTTCCGTACCACCTTGATAAG
AGACGGGATGACACCCGCTTGCGCTGCATGAGTCTGCCGGTTTCGATTAATCCGACACAGGTAAAACATCGACTGGAGCACGATATTTTCCACTTCTTTC
CGCTTGGCATCGGAGATGGAAGGACCTCCTGCCTCCTGCTCATTCAGCAGACGAACAAGCGTCGGGATAGCTCCTGCTCGGTCAAGTTTCTCCAGTGTCA
ATGGCTCCATACTCAAGTTCCGGATGCATTTGAGTACCTTTAGCATCGCAGAAACGAACTCATCCGAGTGTCGAATCAGTGGCAAAACTCGCTTGCTCTC
TTGCTGTAGCTCGCCTGAACCAAACAGTGGAGCGCCTGGGTGGATCGCTTCGAGTAAACCCTCCAACACAGCACCATCACACATGTGCTCCTTCACCACA
GCGTCGCCTTGAGAGAACAAGACGAATATGTCACAGATCGTGTGCAGTTCCTTCATCGTCCATGTTGCACTGGCTTTGGGTTTCTCCAAATTACCTTCGT
TTTCTGCGTCACGCGTATCACTGGCAGCCACAGAGACGACAATGTCTGAGAAAACAATCACAAACTTCTTCAAAAGCCCTGCCTTGACGAAAAGACGGCA
AATGTCGTTCTTCGGGATCGTCTGGATGCTGAATACACTGAAGATTCCGTCCAAGGCGATCCGAAGCAGATCCACATCGGCTTGTAGGGTAGGTCGCTTA
TCTTCCAGCGTCAAGaagtccaccagcacagGTAATCCACCACACGCAATAAACatctgcagcgtcaaggagctcgtTTTGCAGCACTGTCGCACAAAct
tggcagcttccatcCTTACCCCGATCGAAAATTCATAATCCTCGGTACCGTCCATACGAAACCCTCGCCCACTTTCGCCCGGGAAATAGTATGGATTGTG
CTGCTTTGTAAGTTTGATGATCACTGGCACAAGACCAACCAGTGCCAAGTTTTCTTGGAACTTCTTGTTGCCCTCGACAATAATGTTGATAACCCGGAGC
ACAGCGTGCAGCACGTCcattttcttcatctccaggGCCTCCATGATATTCGGCACCACACCCGGTTGGGACATCAAGTCCCGCCTTAGCGTCGCATTCT
GGTCAAACAGTTCCTCCTGCAAAGTGTCAGCACAATACCAGTCAGCAAACACGGATATTTAGTGATTATCATCGTGACTTACCAGGTTATTGCAAGCATC
GAGAATGACTTGATCTTCCATACTGGGATCAAGTAAAGAGAGCAACTCCACCACTCGAGCAGTAGCCTTCTGATTTGAGTCACGAGCGGTGGAATAGTCA
AAGTCCAGCTCATCGTCAAACAAGTTATCTGGGGCACTACCAGATGAAGACCCTCCATTACTCCCGCGATTGCTGGTAAGGCGTAACACTAGATTCCCCA
CTTGGCCATCTGCGAACTCAAAGTCTCCATCCATATCGTCGTTTTCCTTGAAGGCGCTAAGTGTCTTCTTGGCTGGAATTACAGTAGCAGCTATAGGATC
CGTTTCCATTGCCCGTtgctgctttgctgctgcttgtaaAAGCTGGTTTTCATCGATATCGTCAAAAGCGAGGTCTTCCTCTGGGTCTTCGACAAATTGT
TGGAGCTTCGCTATACGACTTTGAGCAGGAATCAGCGATGATCGATCCCACGAGTTCAACGAAGGTTTATCCGTTCTGGTCTGGTTAGTGCTGGCGCCGG
TACTGCCATAGCTCATATCCAGCACAGCAGACCGTTCGGACAacacagcagcttcgggctcttcgtcttcgtcctcccACACGTCGTCGTTGAATAGTGC
ATTAGCATCTTCTTTTGACAGCTGGAACTTCGGTTTGTCTGATGCAGTACCCATCGAAGGCTTCGGCTTGCTGGCTTTTCTGGTCCCGTCTTCTCTGAGT
ACGAACGGCGTGGGGTTCGAGTCCACgccgaactcgtcgtccCAATCCTCAACATCCTCGTCGGATTGTTCGTTGGTGACACTGAGAGAGTTCGAGGTCT
TGCCcgttgtggctgctggtacttctgTAGTAGACGAGCTTTTCTCGTATAGTTTGATGGTGTTCAGCACTGCATCGCGATCATTCATAGAGGTAACGCT
TTCGGCGACGAGCTGTGTGCTTTGTTCCACCTTGTTCTTCGGGATCTGAGCGATCCACGGGTGCATTAGGAGTTCCTCCGCTGAAGCTCGTAGTCGCGGC
TCCTTCATGAAGCATTTCATTATAAAGTCGTGTAAGGCCTACGGCATCAAATTAAAGAAACAAATAGTGAGTAGAGCATACATATTGCTACAACCACTTT
GCAAATTTGTACCGGTGACATTCGCTGTGGAAGTGGCGGATGATCTTCTTGTACAATTCGGAATAATGCAGCCATTGGCGCTAAGTCGAAGTATGGCGGC
TTGGTGGTCAATAGCTCAATAATTGTGCAGCCCACACTCCAGATATCCGACGCAGAGGACCCACCTGACATCTCAATTACCTCCGGTGCCACTACATCCC
ACATGTCGTTAGTATAAGAATAACGAGTCACTTTAAGACTGGTGTTACAACGTACTCCAGTAGGGAGACCCCACGACGGAATTGGCTTTCTGTGTCTCGT
TTAACTTGATAGCGACCCCGAAATCCGCCAATTTCACCAGACCGTCCTTGGTCGTAAGAATGTTCGCTCCTTTGACGTCTCGATGCAGCACACCTTGCTC
GTGCAGATACGCCAGTCCTCGTAGCACTTGGGTGATGTACATGGCCACGAGAGTCTCGGACAATGACCCGAACTTCTTAATAAATTGTGCCAACGAGCCG
TTCTCCATGTATTCCAGCACAATGTACAGATATCCCTGCGTCTTGATGGTGTCGTGGTATTTGACGATGTTCTCATGATTCAATTTACGCAGTAAACTGA
TCTCCGTCTAGAAATACAGCGTAAAGCGCGTCAGATCCTTCCACAGTATCTCTTAATTAATGCTTTCTCGTGTTGTACCTCAATTGACAGCAGTTCATCC
TTGTCAATATCCCGCAGTGACACTTGTTTGATAGCTACAGAGCGTCCATTACGCAAGTCCAGAGCTCCATACACTACACCGAAGCCTCCGCGTCCAATCT
CAGCCCCCAATTGCTA