Description :
From Genome Similarity Track
Location :
contig_50:31521- 34568
Transcript NameFunction/comments
g10352.t1hypothetical protein

Sequence
3047 bases(100 bases per row)
GCATCGAACATCCTCAAAAGATCTCGCTCAGCGTAACTGGCTAGCAAGCCATCGATCATAGTCGTTTTCTTGTCGGGATACCGCTGGTTGAAGTCACTCA
GATACTTGGCCCAGGTTTCGAAACGTGGATCGGTAAAAACCTTTGCGTCTGCCGTGGGCTGTCGTAGAATCCAGTTGAAAGTAGCACTTGGAGGCTTCTC
CATGACAAGCCAACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAATTTTCAGAGTGCTTGGATTTTGCAACCCCTTGTTAGCCATCGATTCAACACCT
CCATCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCTGGATTCCCCTGGTCGAACGTTTTCACGTAGGTGAGCCACGTCTTGAACAGTG
GATTGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGAAGACTTCATCGGGAGATTTGTTGCTGGCGAGATAGCTCTGGATCTGATAAGT
ATATAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATGTATTAGTTGTTTTAGTACGGAAGCCTTAAATGACTAAACGCTGCCCAGCGTA
GTACAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAAGAACGCAAGTATATCTGGTATAAAATCCAACCGATGGTCTGTCCCTTCCAAA
TGAAACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGGAAGTAGATCACTGTAACAAGCGGATAGTTGCCAGCACCGGTACCCTCGACCA
CATTAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAATGAAGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTA
GACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAAATTGTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATC
GATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTCTACTGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTCATGCATACC
AAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGGCTGGTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATAGTACCATAT
CCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTCTATATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAGGAAACTTGT
TGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATTTTTCAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCAT
CGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAAACCGGCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACC
GCAGACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCACTAACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAA
CACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGCCAACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGA
TGAAACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAA
GATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGGCACTTCACCGAG
CTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGATTATCG
GAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTC
GACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAACGCGCACCACTCTCAATT
AAGAGAGAAACTATCAAATACTATAGTCAATCGATACACACAGCAGTTAAACTATCACTTCGGGGGACAACTGCTAGTCAGTCACCTCGAATAGCAAGGG
AATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTTTGGTCACCACCTAAC
TGGACTTGATGATATGAGGTGGAGATGCTACAGACGACCCGTCCTTAATGGTCGCAGTGCCCCTTTTTGTATCGCGGTCGTAGTCTCGGGTCCTCCGGAT
TTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGGTAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAACTCTTTCTAGATCTC
GGCTCTGGGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGTGTCG
ACTCGACAGTTCTGTTGGGTTCTTTGGCGGTAGTTCAATGGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACCGTCA
AGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACTTGGGT
GTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTTC
CGCCAGGCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGAC